Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12012  (registered. 2012)
Contig Information
Length 603 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400782|gb|AAP80623.1|AF475101_1|AF475101_1 H-protein [Triticum aestivum]
Score 273
Evalue 7.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12012
AGCGGCGGCGGCGGCGGGTGAGCTCGCGCATAACGGATCGATCCCAGCTCTAGAGGGGAGCAGCCATGGCGGGGGACGGCGACGAGGAGCCGCCGGCGAC
GGGCGGCGACAAGCTGATCCTGCGGGGCCTGCAGTTCCACGGGTTCCACGGCGTGAAGCAGGAGGAGAAGAAGCTGGGCCAGAAGTTCGTGGTCGACGTG
GACGCCTGGATGGACCTCGCCGCCGCCGGGGACTCGGACGACATCGCCCACACCGTCAGCTACACCGACATCTACAGGATAGCCAAGGGCGTGGTGGAAG
GCCCGTCGCGCAACCTCTTGGAGTCGGTGGCTCAGTCGATCGCCGGCTCCACGCTGCTCGAGTTCCCCCAGATCTCCGCCGTCCGGGTGAAGGTCGGGAA
GCCCCACGTCGCGGTGCAGGGCATCGTCGACTACCTGGGTGTGGAGATACTGAGGCGCAGAGGGGCATGAGCACAAGAACTGAACAGAATTCATCTCAGT
TGAGCCGATCGATCTCTGTCTCTTATACCTATGTGTGAATGAACATATGTTGATTGCGCTCATGAAACAAGAATCACGAACAGAATAATTTCTGAAATGG
GGA
page-top