Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24968  (registered. 2007)
Contig Information
Length 1002 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 8
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoribulokinase, chloroplastic; Short=PRKase; Short=PRK; AltName: Full=Phosphopentokinase; Flags: Precursor >gi|100839|pir||S15743 phosphoribulokinase (EC 2.7.1.19) - wheat >gi|5924030|emb|CAB56544.1| phosphoribulokinase [Triticum aestivum]
Score 1036
Evalue 1.07993e-110
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24968
TTTTTTTTTTGATTCTAGCAAGCACATGTATTTTCTGCATTGAAACATGGGAGAAGATGTACATTGAAATGTGTTAAGAAGAGACATAAGAGACCCTCAT
CATGGAGAGGATTTTCGAGAAGTTCAAAATGCAGGTTTTCATGACTTCTGCAGTGAACTTTCTACCGTCTTCTAGCTGTAATATATTCAAACTAGGTACA
AGAAATGCGAGGATGCTCATTCTCATAGAGTTGGTGATGAAACGATTCGTGGACTTGAATTTGGGGCTGATCAAACTTTTGCTGCTTCAGCAGGAACGCC
GGCCCTCTCAGCGATGATCTGTTCATAGAGATCTCTAATCTTCAGTCCTACGATGGTCTGGAAGAGACCTGTTCCATTGTTGCTGCCTGGGAAGTCTGCA
TGCTTTAGCATTTGCTGTGTCACCTCCCCGTAGAACTTGGTTGAGAGGTTGCTTAGGTGGCTCTCAACATAGATGAGTTCATCTAGTCTGTCAAATTGCC
CATCCATCTCCAGCACCGATACCTCTTGGCCAAAGTAAGTGTCTGGGCCATAGGAAAATTTGATGCCAGGATAAGAGCATGTAAGCTTTCTTCCACAAGG
GATCCAGTTGATGGTTGATCCTTCATCGAAGAGGTAAACTGGGTTGAAGAACTTAATGCCTTCTTTCATGATCAATTTAACACGCAGCACCTTTCCTTCG
TTGTCATCAGGAATCAGCTGGGTTGGCAGAACTTCAATCACAGCATCAGCGTATTGCTTCTGCGGATCAATAAAGGCATCAAAATCAGGTTTCCTGGCTT
CGATGCTAGCCTTGATGCTTTCAAGACTGTGCCCCACGCTCTGCCCATGTCTCTCTGAATTTTCCATGCGAACTTAACCTCATTGCTGATGTCTAAGTAG
ATGCTGAAATCAAGGAGCTCCCTCACACGTTCATCGTACATTGGGGTGCAAACCCTCGATGACGAAGATCTTGGGGGGCTGGATGAGCTCCGCCGGGTCG
AG
page-top