Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24964  (registered. 2007)
Contig Information
Length 1150 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 15
Wh_SHC Shoot grown with cold treatment 3
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1353
Evalue 2.30704e-147
Total Hit Count 416
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24964
ATCCGCCGCCTCCTCCCACCCTCCACAAACCCACGCAGCTCCAGCGGCGCAGGCGCATCCCAGCTCACCGGCGGAGATGGGCGGCCCAGGCCTCTACTCC
GGGATCGGCAAGAAGGCCAAGGATCTGCTATACAGGGACTACCAGACCGACCACAAGTTCACCCTCACCACCTACACCGCCAATGGCGCCGCAATTACTG
CTACCAGTACAAAGAAGGCTGATCTTATACTTGGTGAGATCCAATCACAGATCAAGAACAAAAACATCACTGTAGATGTGAAGGCAAACTCAGCATCGAA
TGTCATTACTACAATTACCGCTGACGATCTTGCAGCACCAGGGCTGAAGACCATCTTGAGCTTTGCTGTTCCTGATCAGAAATCTGGAAAGGTTGAGCTC
CAGTACTTGCATGATTATGCTGGTATTAATGCAAGCATTGGCTTGACTGCCAATCCTGTAGTCAACCTCTCCGGTGCGTTCGGAACTAGTGCTCTAGCTG
TTGGTGCTGATGTGTCGCTTGATACAGCCACCAAGAATTTCACCAAATACAATGCTGCACTTAGCTACACTAACCAGGATCTTATTGCATCCCTGAACCT
GAACAACAAGGGAGACAGCCTGACCGCATCCTATTACCACATTGTGGAGAAGTCCGGCACAGCTGTCGGGGCGGAGCTGACCCACAGCTTCTCGAGCAAC
GAGAACAGCCTCACCTTTGGCACCCAGCATACCCTGGACCCGCTCACCCTTGTGAAGGCCCGGATCAACAACTCTGGCAAGGCCAGCGCGCTGATCCAGC
ACGAGTTCATGCCAAAGTCGTTGTGCACCATCTCGGCGGAGGTGGACACCAAGGCCATCGAGAAGAGCTCGAAGGTCGGCATTGCTATTGCTCTCAAGCC
TTGATTGCGAAATCAAGCCCCCCATTCTCTAAAGCTCTCAGTCAGGGGTGTTCCTCGGTTTCGGATGAAATCGGGGCGGGTTGACAATACTTCACACGCC
TTGGGCGCGTTGTTGCAGTCTGTTAGATTTGAAGAACTGCCGTGTTTCATTCCTGAGGAATTTTGTCTTTGCTCGGTGTAGTGCCTGTCCGTTGAGCCAC
ACTTCTCAGTAATAATTCAAGCTCTGAAAATTCCGAACTTAAAAAAAAAA
page-top