Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24949  (registered. 2007)
Contig Information
Length 867 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 10
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Photosystem I reaction center subunit XI, chloroplastic; Short=PSI-L; AltName: Full=PSI subunit V; Flags: Precursor >gi|167087|gb|AAA62700.1| photosystem I hydrophobic protein
Score 999
Evalue 1.64945e-106
Total Hit Count 132
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24949
ATCCATCCATTTGTAGCTGCAGGCAGAGCAGAGTTGTGCGTGTGGGAGTTGAAGGAGATCGAGATGGCCACAGCATATGCTCCTCCGATGGCGAGCCAGG
TGATGAAGAGCGGCTTGGTGTGCTCCAAGCCGCGGGGCATGTCCGGCGCTTCGCTCACCAGGAGGCCCCGCCTCGTCGTCAAGGCCGTCAAGTCTGACAA
GCCGACGTACCAGGTGGTCCAGCCCATCAACGGCGACCCATTCATCGGCAGCCTGGAGACGCCCGTCACCTCCAGCCCCCTCGTCGCCTGGTACCTCTCA
AACCTCCCCGCCTACCGCACCGCCGTCAGCCCGCTCCTCCGCGGCATCGAGGTCGGCCTCGCCCACGGCTACCTCCTGGTCGGCCCCTTCGCGCTCACCG
GCCCGCTCCGCAACACGCCAATTCACGGCCAGGCAGGCACTCTCGGCGCCATCGGCCTCGTCTCCATCCTTAGCGTCTGCCTCACCATGTACGGTGTCGC
GTCCTTCAACGAGGGCGCACCGTCAACCGCGCCCGCACTCACGCTCACAGGCCGCAAGAAGGAGGCCGACAAGCTGCAGACCGCTGAAGGGTGGTCGCAG
TTCACCGGAGGCTTCTTCTTCGGTGGTGTCTCCGGTGCCACCTGGGCCTACTTCCTCCTCTACGTGCTCGACCTCCCATACTTCTTCAAGTAGATTAATT
ATTGGCATGCATGTAGCGATGGGTGCAGATCATGTGATCTCTTCCCGATGGTGGTTGCTTCAAAGAGTCCATGTATAAATGAATTTACACATTCCTCACA
ATCTTTGCATGGATCGATCATACTACGATACTATAACATGCGAATTGCTAATTTCTTAAAAAAAAAA
page-top