Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24946  (registered. 2007)
Contig Information
Length 827 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 10
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VABA Shoot with ABA treatment 13
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit stress responsive protein [Triticum aestivum]
Score 1059
Evalue 1.67478e-113
Total Hit Count 91
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24946
TTTTTTTTTTATCAGCTCACAAAGGTCCTTTATTGTTACGTAACTTGTCATTACACATACAAGCACAACAGCTCCGTTATTCTGCAGCGTAGATAGCGAG
AGACGCATGCATGTTTTTATCCAGGACAGACCACAACTCCACATCGTTTCTTCAGTAGATACGTACGCACGCATGGGTAGGTATGGGTATGTGTATGTCG
ATCTGCACGCGTACGTGCACGAGCCATGCATGATGCATGCACGGCGCGCGCTGGCTGGCTCAGTAGTACGGCTGGAGCTTCCAGCGTTGGTTGTCGCCCT
CGCACCACTTCCAGAGCACGACCTCGGTGCCGTCGCGCACGCCGCCGTGGTACTTGTCGCCGTTGAGGGCGTCGAAGTTGAGGTAGATGTTGTTCACCAT
GCGCACACACCTGAAGCCGTTGCCCACGTCCCTGCTCTCCGTCCACAGCACCGACTCGTCCAGGTAGTCTGGGTTGTACGGCACCAGACGCACAGGGTGG
GACTGGCCGAGGGAGTGCTTGATGGCCTGCCCGGTGGCCTTGTTCACCATGGCGAAGGCGGGGTACCCCTCCTCGTCCTTGATGCTGGTGCTCCACCTCA
TGTCCTTGATCCAGTGCTGGTAGTCGTCCTTGGGGTTGGCCGGCGCCAGCACCACCTTGCCGTTGCGCACGGACATGGCGTAGTTGGGGTTGGCGCGGCA
GTAGATCTTCACCGTCGGCTGCGGCGGCATGGGGCGCCCGCCGCAGTTGCCGTCGATGTTCACCTGCGACATGCCGTACGGCACCGGCGCCGCGTACCCG
GGCGTCGCCATCCCGTACCCGCCGTAG
page-top