Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24944  (registered. 2007)
Contig Information
Length 745 bp
Clones 48 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L27a-3 [Zea mays] >gi|195621814|gb|ACG32737.1| 60S ribosomal protein L27a-3 [Zea mays]
Score 599
Evalue 3.02182e-60
Total Hit Count 427
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24944
TTTTTTTTTTGGGGATTAACACAGATCAAACGAAACATAAATAGGAGCACAGATATGGATAACTCGTCTGATATAAACTGGCATAACATAGCGCAAAATT
CTCATAAGATGTTGGTTTACCACACAGGAACCAGGATAACAAACTAACGATGTCTTGTTCAACACAAATTGCTGGTACGGGAAACAACTAATAGTTCAGA
TATAATAGATCTCAAGGCACGGTCGCGAACAGAACCCTAGGCAACGAGCACGACAGCGCCGCCGGCGGCCTTGATCTTCTTCTCTGCGATCTTGGAGATG
AGCTTGGCCTTGACGACGATGGGCTTCTCCGGCAGCATCCCCTTGCCGAGCACCTTGAAGTAGCCGAACTGCGAGACGTCGACCACGGGGGCCTTGTCGC
CGCCGGCCTCGGCCGCCTTCTCGGACGGCACCATGGACCAGAGCCTCTCGACGTTGACCGTCGGGGTGTAGAACCTGTTGCTGAGCTTGTGGAAGTAGCG
CATACCGACCTTGCCGAAGTAGCCGGGATGGTACTTGTCGAAGAGGATGCGGTGGTGGTGCATGCCTCCGGCGTTACCGCGGCCTCCGGGATGCTTGCGG
TGCTTGCCCACACGCCCGTGCCCGGCGGACACGTGGCCGCGCTTCTTCCGGTTCTTCTTGAAGCGGGTCGTCATCGCCGCCGCTCGCTCGCCGCCGCCGC
GGGCTTACCTTGGAGGAGAGGGGTCGGGGCGGGTGGGGTGGAGGC
page-top