Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24914  (registered. 2007)
Contig Information
Length 1237 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 18
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0327400 [Oryza sativa (japonica cultivar-group)] >gi|48716905|dbj|BAD23600.1| apospory-associated protein C-like [Oryza sativa Japonica Group] >gi|113631123|dbj|BAF24804.1| Os09g0327400 [Oryza sativa (japonica cultivar-group)] >gi|215697032|dbj|BAG91026.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1456
Evalue 2.93711e-159
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24914
TTGTCTAGAGCTAGATACATCTTACATGGAAAAATGTTAACCCTGTCTCATTCAACTATGAGCAGAACATACAAGATAGCCGACCACCACAGAGAAGGGA
AATAAGAACTGAATTACTTTATTTACTTATAAAACATAAAATAGTTATAAGATGTACATCTGATGTGAGGGCATAAGTTGAAGTACACCGGGGAATGACA
CATGTTTACACTGCCAGACACGTAAAAGGGCCCTTTGACGTCGCCGCACTGTACTGTTCTCAACCCATTAGCTTCAGACAAGTTCAATTTTCTGCTCTGC
CACCCAAGATTCTTTTGGACCCAGTTGTACTGTTTCAATCTTTGCATTTTCAACACAAACAAAGTCTTTGTAGCATGCCTCCATCTGCAAATGAGGATTC
CACAACACTGCATCTGACCAGTTTGTGTTTGAGATTACAATTTTGTCACCCAATCCATTGTCCAGTGTAAGCTCAGTCGGTGCGCCAAGGTAAACACAGT
CCACAAATCCTGGAAAGGTCACCTCGTCCCTTTCTTCTTTGCCCTCCAGAGGATTTTTAGGATCAGGATCCTTATTGAGAGTCTTGCTACCTTTGAGACC
TTTCACTGAAACACCAGCGATGGAAGCACTGAAATAAGTGTGGAGGGCTGAGTTGAACGAGAAAGGTTTATCGTCTGTATTTATTATTTTCAGGGTCGTT
GACAGGCTTGTAGAGTGCAGCACAACCTTGTATAAAGCTTGGAAACTAAAATCCCACATTGAACGGCTGTACGAGTCGTCTTTTAGTTCCAAAGTTACAG
TTGGATCTCCTTCTGTGACTTCTGAATCAGTAATAGACCAATTCACATTCCTGGCAAATCCATGCTGCTGCATGGGACCGGGGCCAAACTGGGGGAAACA
ATGTGGAATTCCACCGCTGATGGGTTTCTGGCCATTGAACACGGCATCTGGTCTGACAAAGAGCAGGTCCTTTCCACTGGGAACCTTCCAAGATGTGACA
CATGCTCCAAATAGATAAATCTCAGCCTCACTCCCGTGCGGGGATTTGAGGCTGATCTTGGGCAGGCCGCCGTTGCCGTCGGAGACGGCCACGCCGGGCG
CGTACACCTTCTGCCCCACGCTGGCCATGGCAACCACCCCGAATCGCCTGTACCGACGGGCTGAAGTGGAGGAGGAGGAGGAGGCGGCGGCGAAGGGGGC
GGGGACGGTGAGCGTGCAGGAAGCCGCCATTTCTGCT
page-top