Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24904  (registered. 2007)
Contig Information
Length 1303 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 12
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein [Hordeum vulgare]
Score 1209
Evalue 5.44707e-137
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24904
TTCGAAAGCCCAAGCGCGACGAGGAGACCAGCGGCGACACACGCAGACGCAGATTTGGCATTCAGAAAAAATTGAAATTGTGAACTGTGAAGATGACGGC
ACCAGCGGAGCTTTCCCGTGAGGAGAATGTGTACATGGCTAAGCTCGCCGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCC
AAGACCGTCGACTCCGAGGAACTCACTGTGGAGGAGCGCAACCTGCTCTCTGTTGCATACAAGAATGTGATTGGAGCCCGCCGTGCCTCATGGCGCATCA
TCTCCTCCATTGAGCAGAAGGAGGAGAGCCGTGGCAACGAGGACCGGGTCACGCTCATCAAGGAGTACCGTGGCAAGATCGAGACTGAGCTTAGCAAGAT
CTGTGATGGCATCCTCAAGCTGCTCGAAACCCACCTTGTCCCGTCTTCCACTGCCCCTGAGTCCAAGGTCTTCTATCTTAAGATGAAGGGTGACTACTAC
AGATATCTTGCCGAATTCAAGAGTGGGCCTGAGAGGAAGGATGCTGCTGAGAATACCATGGTGGCATACAAGGCTGCTCAGGATATTGCTTTGGCTGAGC
TGGCTCCAACTCATCCGATTAGGCTTGGGCTGGCACTGAACTTCTCGGTGTTCTATTATGAGATCCTCAACTCGCCTGATCGTGCTTGCAATCTCGCAAA
GCAGGCATTCGATGAGGCCATTTCGGAGCTGGACACCCTGAGCGAAGAATCCTACAAGGACAGCACCTTGATCATGCAACTCCTTCGTGATAACTTGACC
CTCTGGACTTCTGACATCACGGTATCGTCTATTTCGCAAGCGCACCTTTTATCTTGTCGTGTTCTTTGAAACCATCCTTCCCCCTTGAACAACCGTAACC
GACTTCCTTGGCTTTTTATCAGGAGGACACCGCGGAGGAGGAGATCAGGGAGGCTCCGAAGCATGACTCCAGCGAGGGGCAGTAAAGCCGGCTTTGCGAT
GCCCCGCAAGCTACTAGCTAGTGTTTGCTACTGTCAATGACCGTTGCAATGTGCTCTGGATCGTGTGGTAGATGTGTTATGGTTATTATTGCAAGATTTG
GGGCTCCCCATATGTTATGTTGCCAGGGAAGGTTGTGGTCGCCGCTTGTAGCGTAGCAGGCGGGGACTGCCTCCTTGGTCTGGCCTGGGGGGAGCCCCAT
ACAGTGGTGGTGGTGGCCGTTCGTATTTTCGTTCTGCCTTAATATTGCTTCTTATCGTGAGTGATCCTGCGTTCTGTGTCTGGGCCCTGTTCTGTTTCAG
TTT
page-top