Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24902  (registered. 2007)
Contig Information
Length 1035 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L18 [Triticum aestivum]
Score 948
Evalue 1.79766e-100
Total Hit Count 350
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24902
GTGCCGGGACGAGGTAAGAAGAAGCAGCCGCAGCCGCAGCGCGACCCCGCGAGGAAACCCTACCGCCGCCGCAGCAGGAGCAGCCATGGGTATCGACCTC
GTCGCCGGCGGGAGGAACAAGAGGACCAAGCGCGTCGCGCCCAAGTCCGACGATGTCTACCTCAAGCTCCTCGTCAAGCTCTACCGTTTCCTGGTGAGGA
GGACCAAGAGCAAGTTCAACGCCGTCATCCTCAAGAGGCTCTTCATGAGCAAGACTAACCGCCCGCCGCTCTCCATGCGCCGCCTCTCCAACTTCATGAA
GGGAAAGGAGGAGAAGAACATTGCTGTGGTTGTTGGTACAATCACAGATGACATGCGGATCCAAGAGGTCCCAGCAATGAAGGTTACCGCTCTGAGGTTC
ACAGAGACAGCGAGGGCAAGGATTGTCAATGCTGGTGGGGAGTGCCTCACTTTTGACCAGCTTGCACTCCGTGCTCCAACTGGGGAGAACACTATCCTGT
TGAGGGGACCCAAGAATGCCCGTGAGGCGGTGAGGCACTTCGGCAAAGCACCTGGTGTGCCGCACAGCCATACCAAGCCCTATGTGCGCTCCAAGGGTAG
GAAGTTTGAGAAGGCTCGTGGTAGGAGGAACAGCCGTGGCTTCAAGGTTTAAGTCGCCCTTTCTTGTTAGTCGCTGTTTGCGTGGAGCGGCTGTTGTTCT
GTTTGAGCAATTGACAGTAATTAGTAAAGTACTTTGTACTGAGAGTAGCAAAATCTATCGCCCCAGTGTTTGAATGATATTTTGCAAGATTCTTATCGCT
GTCAACTCTTTTGATTTTGTGAGCTTGAAGACCATGTTTCGTTGCAACCAGTCATTGCTTAGCTTCAGCGCCTTGCAATATCTTTGCTTGGCGATGTCCA
TTGTCTCTTAAGTGATGTTCATTGTATTTGGTTAGCTTCAGTGCCTCTGCAGTATCTTTGCTTGAAGTACAGCTATCCCACGTGTCGTTGTAGTAACGCA
GTTTTCGAGGGTGAACTTAAACTTGAAAAGAAAAT
page-top