Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24901  (registered. 2007)
Contig Information
Length 1071 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 7
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 7
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L13a [Triticum aestivum]
Score 989
Evalue 3.36368e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24901
CAATCTTTATCTTTAATATGTGTGCAGTATCCCGCACAAACAGTAGCTTTACTAGAATTTTCATGCCGCTAATCTGATGAGTGAAAAAGAAAGACATGTA
CAAAGGCAAACACATTACTTCTAACTTTCCAACGATAGGTCAAGAGACTGCCATGGGCTGTAGTAAAGAGAAACAGCCTCAGCAACATATAATCACCTGA
TAGACATGCACTAGAATCTCCAAATGCACACATTTGATAAACGAAACAGTTCACCAAGTAGAAAATTTCAAATGAGGGTAGCAGAACTGCATGCATAACA
AAGGTTTACCAACCAGGTTGTACTATCACAGAGTTACCAAACTACTCAAAGACAAGAGGACAGAGGTTTCCCAAAACTGATGGCGCACGGAAGCTCTAAT
CTCTCTTAGTATTTGATCGGGGCTAGGATCTCCAGCTGAGTTCCCAACTTCTCCTCGGCCGCCTTCTCGGCCTTGACGCGGAGCTTCGCCAGTTGCTTTC
TCCTGTCGTAGGAGACCTTGGCCTTCTCCTTTCTCTTTTCCTCCAGCTCCCTGATGGTGTCGGCGTAGTTCCATCCGACCTCCTTGGAGAGCTGGCCGAG
GAGGCAGTACCTGTGCCCAGGCTGCAGCCTCAGAACCTTGAGCGCGTCGGGGATGACCATGCGCTTGGTCCTGTCGTACGGCGGCGGGACGCCCTCGTAC
GCCTTGAGCCTGGCGAGCGCGGCCTCGCCCCTCGCGGTCTTGTGCGGAATCATACCGCGGATGGTGCGCCAGAGGATCTTGGCCGGGGCGCGGAAGTGGA
TGGGGCCGTGGGAGGGCTTGGTGTTCATCCGCTTGCGGAGGAAGCGGAGGTACTTCATCTTCTGGCGGACGAGGCCGCCGGACATGCAGATCTCCTCGCA
GCGGACCACCACCACGCGCTGCCCGTTGAGCAGCTCCTTGGCGACGATCGAGGCCAGGCGGCCGAGCATGTGGTGGCGGGCGTCCACCACCACGCGCTTG
GCGCACACGCCGGAGCCGGACACCATCTCGCCTCTTACCTGGCGGCGGCGGCGCTACTGCTAGGGTTGGAG
page-top