Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24900  (registered. 2007)
Contig Information
Length 775 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60s ribosomal protein L21 [Triticum aestivum]
Score 863
Evalue 7.97243e-91
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24900
TTTTTTGCCCAATCGACCAAAAAGCAAAATATATCCAGCAGCATGAGTGCATGACGAGAATGAAATCAACCACAGGAAATCTTTAATGTTAACCACAGAG
AAGTTCACACTCGGCGGAGCAAAAAGAGAACTACTCGGTACCAAGACATTGGGAACAAGCATAGATACTAAGAACTGGCTCAAGCTTCAGCTCAGGAAGC
AAGCGCTCTAGTAGCCACCCTTGAGATCGTTGACGACGTCATACGGGATGGGGGTGACCGTCTCGATGGTGGTGCCCTCAACCATGAACCCCGGCTTGGG
CCCTGCTGGCTGCCTCTTGGTGCTGATGACCTCGCCGCGCGCCTTGGCCTCCGCCTTCAGCTTGTCGTTGTTGAGTTTCCTCTGGAGGAACTCCTCGTTG
CACCTGGATGGCTGCACGTGCTCCACACGGACATGGATCCTCTTCTTGATGATCCTGTTGCCGACCTGCTTGTTGATCTCGACGCCGATGGCGCGCTTGG
TGACGTTGCAGACGCGGCCGGTGCGGCCGTGGTAGAACTTGTGCGGCATGCCCTTGTGGACGGCGCCGTTCACCTTGACGTCGACGTGCTCGCCGACCTT
GTAGGTGCGCAGGTAGGTGGTGAGCGGGATGTACCCCTTCTTGCGGAACGGCCGCGCGAACAGGTCGCGCGTCCGCGACCGCAGCCCGTGCCCCGCCGGC
ATCTTCCCCTTCCTTCCTCCTTGCCTTCTCTCCCTGCGGCTCTGCGGCGGCGGCGGCGGCGGGCGGGGGAGTGTG
page-top