Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24895  (registered. 2007)
Contig Information
Length 1051 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 860
Evalue 2.94582e-90
Total Hit Count 425
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24895
TTTTTTTTTTCAAACCAAAAAACAGCTCCGGCGTCCAGGCATCTAAGGGAGAAAAGTAGGCGAGTACACACAAGTAGCTCCGATGAAGACGGCAGACAGA
AGAGAATAGCAACAGGAATCCAACCACATTGTCTCATTTCATACGAAGCAAATAACACTCAGTAGTAATACTACGAATCAACTCGATCTAAGGTCCAAAA
ACCTCACAGGGCAGATATGTTATGCTTGCTTTAGCTACGACACCATCACGGCAACAGAAAACTGTAGATATATTGTGCGCCCACCGCCATCACCTGCCTC
AGGAAGATTTAGATTTTGTTGAAGGCAACAATGTCACAGCTCTGGATGTACTCGTTGGCTGGTTCAACGCAGAGATGGTCTTCAATAAGAGTGTCGACAG
AGACGAGGTCATCAATGATGGTCATCATAATCTGGAGCTTCTTGATGCCATATCCAACGGGCATGAGCTTGGAAGCACCCCACAGAAGGCCCTCCATCTT
GATGCTTCGGACAGCTTCCTCCAGCTTGACCATGTCGGTCTCATCGTCCCATGGCTTAACATCAAGCAAAACTGATGACTTGCCAGATTCTTTCTTCTTG
GTAGAAGCCTTTGCTTTGGCAGCGCGCTCTTCAGCTGCCTTTTTCTCCTCCTCGGTTTCCTCTCCAAAAAGGTCAACATCGCTGTCATCGTCATCATCAG
CTGCAGGAGCCTCAGCAACATCAGTAGTTGAGGTTTCAGGGACAACTGATGACAGAACCTTCACACCTTGACCAGGGGCAGTAACTCCACTCAGCTTCAG
GAGTGCATCAATGTGATTGTACCACCTTGCAACATTGGTGCAAGTTGATGGTGGAGCAACTGAGAACTCTGAATACACAGCCAAGTCATCCTTGGAAGCT
TGGTATCCAGAGATGTAACTGCGAGACAGAAGGTAGCCATCAAGCTTTTTAAGGCCTGCCTCAGCATTAACATTGAAGGTAGCCGCCATCTCAGCCTCAA
AAGGATGGAACAGATGATCTACTCGAGGGAGCGAGTCGAGGTGTGGCCGCG
page-top