Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24863  (registered. 2007)
Contig Information
Length 902 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 9
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 9
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Fructose-bisphosphate aldolase, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 936
Evalue 3.56765e-99
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24863
TTTTTTTTTTGCTGCCAAGCGCCAACCTCATCGCCAATTCATGGTGTACGTACGTACATGCAAAATTTTGCAGTAACCATGCAAATCCATGGATCGCACA
CGTAAAAGTAGCTTTACAATAATCTACTGGACTGTAGCATGAATTGTGCATATCGAGAGGCAAATTAACGAGTAAAAAAAGATCTAGAAAATACAAGTAA
TCATCATCTCAGGCTGAGGCTCCCAGCTCGATCGATCTTTGCACTTGCAGCTGTAGTATCATCATGCATGCATCTTGAATTTCTGCTTTGGTAACGAACG
TACGTAGTAGTGTTGATTGGAATGGTTGGATTAGTAGCTGTAGTTCTTAACGAACATGCCCTCCTTGGCCTCAGCGGCTTCGCCGTCGCTTGTGTACTTT
CCGAGCTGCGCGAGCGAGTTGGCCTTGGCACGCAGCAGCAGCGCCTCCTGCGCCGCCTTGACGTTCTCCGGCCGGCCGCCCCACGTCTTGAGGCACGTGT
TCTGCAGCGCCCTGGCGTAGGAGAAGGAGACGTGCCACGGGTTGGGCCCCTGGTTCATGGCGTTGAGGTTGAGCGTGGCCTCCACCTCGGACTGCCCTCC
CGACAGGAACATGATGCCGGGGACGGCGGGCGGCACGCGGCGGCTGAGGAGCTTGAGGGTGTAGTCGGCGACCTGCTCCGGTGTGGCCCTGTCCTTGCAC
TCGGCGCCGGGGGTGACCATGCTGGGTTTGAGCAGGATGCCCTCGAACATGACGTTGTTCTGGGCCATCTGGTAGAAGGTCTCGGCCCACACCTTCTGCG
CCACCTCGAAGGTGCGCTCGATGCCGTGCTCCCCGTCCAGCAGGATCTCCGGCTCCACGATGGGCACCAGACCGTTGTCCTGCGAGATGGCGGCGTAGCG
GG
page-top