Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24862  (registered. 2007)
Contig Information
Length 760 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_SHDr Shoot grown with dessication 7
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 8
Wh_VABA Shoot with ABA treatment 18
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 382
Evalue 4.56187e-35
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24862
TTTTTTTTTTATCAAAAGTGCTGAATAACATGCGCACGCAAGTACAGCTGATCAGCTGTGTATACAATCCATATATCAAAAGTACACATGGTACAAAGTA
CAGCAACCCTCGGGGAGTGGAGGAACAACCAAACATCGATATAACAGTGTGGCCGGCCATGCAGAGCTGCTTGGACAGTGTGTCTCTCTCTCACGCAGTG
AGATAATATGAGAGCATTTATTCATATATATGTGTGTGTGTGCGTGTGTGTGACCTCAACGTACTAAGCGTAGATCCAGCAACGATGGCGTAGGGGACGT
ACGATAGCAACAACGATGGCAGCAAGTGCTCGATCAGTGAATCTTAGAGCAGTCGACCGAAGAGCTGATGGCGTAGGGGACGCTAACGCCGCACTTTGTG
GGGATGCCGGCGGCCTTGCCAGCATTGAGCCCAGCAGCAGCGCTCTTGATGCACTTGCACACCGCTTGCTTGTCAGCGGTGCTCCGGGCTGAGCTGGCTA
GACTCCTAACGCCGCTGCAGCAGGCCGCAGATGGGCTGGCGCCGTTGCCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGCTCACCTGACCGCACGA
TACGGCCGCCTCCGTGACTGCGAGGAGCATAGCGGCCACCACGGCGACGAGCACGACCTGAGCAACAGCAGAACGGGCCATCTCGATCAAGCTAGCAATA
GTAGTGGTAGTGAGCTCAGGCAGAGATGATGAGATAGCTAGATTTGCTCGGCACGAGGCG
page-top