Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24861  (registered. 2007)
Contig Information
Length 1322 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 16
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor >gi|187663980|sp|Q0J709|UP12_ORYSJ RecName: Full=Unknown protein DS12 from 2D-PAGE of leaf, chloroplastic; Flags: Precursor
Score 803
Evalue 4.80548e-104
Total Hit Count 163
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24861
ACGATTGGCCACACAAGCGGCCCTCTTATTTTATCATCAAACATGCATCCCGGGTAGCAAAATAACCATGTGTTATACTGCCATCTCATAACTTAACTTG
GAAGGCTAGTGCAGTTCATACAGCATGAAGCTGCCTTCACATGAAACTATGAGTACATGATATATCGTGTACCTCCCTTTTTGGGGAATTATGCATATTT
CAGGAATAATTTGGATGATAGTGCAAACTTCATACAAATATCATGTCTCATGAGCTATGATAAGGCGTGGGTTTGTAATCATCTGCTTAGAAACTGGCAT
CCTCTGTTGTCGGCCTCCTCAAGAAATAACGCAAGCTATTCGCGAGAACCTGTTGCAAAGCCTTGATTAATGGCTTGCCCCGGTAACTGACATGGAATTT
TGCCTTGGCCAGTAGCCCCTCAGTGTCAAATTCTCCAGATTGGACAGTGATATTGATGTCAGCAATGATCTTAACTAGATCAACCAACAACCCTGGACGG
TCAGCTGATTCCACAACAAGTAAACTTCTTTCAGGACCATCGTCATAGATCTCTATGTGAGTTGCTATGTCCACATCAACCACTTCCGTAGGGGGCTCTA
GCCCAAAAGTTGCACCCATGGCCAATTGACTGCTAGCTTCAGGATGATACTCAAGCATGTTGTTAATAATTGTCAGTCTTACTGCTTCTAACAACTCTGG
GTCATCAATTTTGCGACCAGTTGACGACTTTGTTATAGCGAACTTATTGTGCTTGCCAGAAGAATCGAGGCAAACACTAGCTTTCACAACATTTAGCCCT
AAATTCCTCAAGGCACTCATAGTATCAAGAAGATCCCCAAGACGGTCACCCAAGGGTTACTTCCACAATAGTTGCATCCGGATCTGAGTCTTGATCTATT
ATAACCTTCGGTGTAGGGACTGTATTACTGTTGCTAGAGCTCCCATTCTCAACAGCTGCAGGCGAAGCAGCTCTAGGAACCCTCAAAGCTGGAGACAATA
ATCTCAGCTTAGCGGGCGCTGCCGGTGCAAGTGGCCGCCACCCGGCAAGCGGATGGTTCCCGGACGCCGCCGGAAATACGCCGGAACAGGTACGGAGGGT
CCCGGCAGCTACGGCGACAGCCATTTCTGGAATCTTCTCCCCCACTCGGCCAAGAAACGTGCGAGGATTGGGATCAAATCTTGTCAAATAAACCCGGGGG
TGGGGTGGGGGAGGGGAGATGGTGCTACAAAGGAGAGGGCGCTGATGGGATCATAGCGAGGATATCTATGGCTGTCGCGGCGGCTCTATCCATAGGATAG
AGAGGTGGAAACGGGAGGTGGC
page-top