Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24857  (registered. 2007)
Contig Information
Length 1303 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 12
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 5
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aquaporin PIP1 [Triticum aestivum]
Score 1457
Evalue 2.40891e-159
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24857
TCTTCTCATCTCCGGCGAGAAGATCGTTAATTAACTCGATCGTCCTTCCTTCATAATACGTAATAATTTACATAGATATGCACGCCCGATTAAATCGCGT
GCGTAGTGCAATACAAAAGGAAGGGAAAGTACAACTCGCAGACTTGAACAGGTGACGCTGCCGACAGGCACACACACCGAGGAGGGGAGGAACAGCACGG
TAGATATAGATGATTACAGCGTGCGCGGCCGAGACATGATCCACGTACTACGCGCGCGCGAGCAACCACCACCACCACCACCACATGATCGATCGACCGA
CGATGAACAGCGATAAGATTCCATTCGCGACTGGTTGATTGGTGGACTAGTCGCGGCTCTTGAAGGGGATGGCCCGGATCACCACCACGTGGTAGATGGC
CGCCAGCGCCGCGCCGATGAACGGGCCCACCCAGAAGATCCAGTGGTCGTCCCACGCCTGCTTCTTGTTGTAGATGATGGCGGCGCCGAGGGACCTCGCC
GGGTTGATGCCGGTCCCCGTGATGGGGATCGTCGCCAGGTGCACCAGGAACACCGCGAACCCGATCGGAAGCGGCGCCAGGATGGGGACGTGGGAGTCTC
TGGCGCTGCGCTTGGCGTCGGTGGCGGAGAAGACGGTGTACACCAGCACGAACGTGCCGACGATCTCGGCGCCGAGCCCGTCCCCCTTGGTGTACCCGGG
CGCGACGGAGTTGGCGCCGCCGCCGTTGCCCTGGTACAGCGTGGTCTGGAACCCCTTCACCACGCCGGCGCCGCATATGGCGCCCAGGCACTGCATGACC
ATGTAGAACACGGCCCTGGTGAGCGACAGCTTCCTGGCCAGGAACAGCCCGAAGGTGACCGCGGGGTTGATGTGGCCGCCGGAGATGCCGGCGGTGCAGT
AGACGAGCACGAAGATCATGCCGCCGAAGCTCCAGGCGATGCCCTGGATGCCGACCGTGCCGCACTTGGACCCGGACGGGTTGCCCACCACGCCCATCAC
GGTGAGCACCGAGATGTAGAGGAAGAGGAAGGTGGCCAGGAACTCGGCGATCCCCGCCCGGTAGAAGGACCAGGAGGTGAGCTCCCCGGCCTCGAAGAAG
GGGGCCGGGGGCGGCTCCTTGTAGTCCTTCTCGTCCGCGCCGCCGCCCTGCGCCGCCGTGCCGATGGGCTGGTGCTCCGAGTAGCGGTTCGCGCCCAGCC
GCACGTCCTCCTCCTTGCCCTCCATGGCCGCTGCTTCACTGGGCTCTTGGCCTTGGCTTGGTTGAGAGGTGGAGGAGATGATGTTTGGAGAGAGAGAGAA
CTA
page-top