Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1200  (registered. 2012)
Contig Information
Length 644 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20152971|gb|AAM13438.1|AF474071_1|AF474071_1 similar to A. thaliana protein BAB01483 similar to kinesin light
Score 402
Evalue 2.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1200
ATTCTGGTGCCGGGGAGCCCTCGATTGAGCAGCTCTACAACAACGTGTGTGAGATGGAGAGCTCAAGTGAGGGCGGCGGATCCCCATCACGCGAGAGCTT
CGGGTCGGATGGGGAGGAATCAAGGATTGACTCTGAGCTTCGCCACCTTGTTGCTGGGGAGATGGAGGCCATGAAGGTCATTGAGGAGGAGGAGGAGAAG
GAGAAGAAGGGGAGTGGAAGTGTTACCAATGTGGTACCTACTGCTGGGAATGGGACCCCTGTCAGGCCTCAGTCTTCTAATTCATCCAAAAAGAAGGCTA
CAAAATCACAGCTTGAATCTGATGCTTCTATTGGCCCCAATGGCAAGGCATCCCCCGAGGAAGGCGAGAGTGAGGTCAGCAAGCCCGGAAGCCGTGTTGG
CCGTCGCCGGAAAGCTAGTGCTAAATCACAGAATGGAACAGAAGATGCTGGGCTCGATAACCCAGACCTTGGTCCATTTCTTCTTAAGCATGCAAGAGAC
TTGATTGCCTCTGATAATCCGCGGCGAGCGCTGAAATATGCTCTNNGTGCCACCAAATCATTTGAGAAATGTGCAGGTGGAAAGCCAAGCTTGAACTTGG
NNNTGAGTTTGCATGTTGTGGCTGCAATTCACTGCAACATGGGA
page-top