Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24850  (registered. 2007)
Contig Information
Length 1268 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1202
Evalue 8.56619e-130
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24850
TTTTTTTTTTAAGCACTGCAAAATTAAGACGGACAAGCTTGAAAGCCAACTTATAACACAAACTTTCAGTCTCCCTCTCCCTCATCACGATGTCGATAGC
AGAGATCACAAATTCATCTAGAAAATCCTAAAACACAGGTTTTTGTCCATAGGGTAGATATAGCAGATCGCATCAGATGCTAGATATCCATTAATGCCTC
ACAAAATATGAACTTTAAGCCACAAAGACATCTCAAGGGAGCATCCTAGTCTACTCCCAGCCTTGAGCAGGGGGTTGCACCGCGGCGTCCCAGCCAGTAG
CAGCCACAACAGGAGCAGGAACGGCACCTTCCACAGCAACAGGTGCCCCTGCTGCATCCCATCCATCGCCACCAGCAACTGGAGCTTCAGCCATCGGCCA
CTCGCCACCAGTAACAGGCGGGGGAGCAGGTGCATCAGAGGTCCACTGGTCACCACCCCATTGACCAGCTGCAGCTCCGTAATCAGTGATGGCAGCATAC
TCTGGGGCTCCAGCAGCTTCATCCTCCTGCTCCTTGGCTTCCTCAGGGTCCCTGTAGAAGAACAGATCAACCATGACATCCCACTTGTGCCCAGGCAGGA
TAGTACCCCTCATCTGCAGAACCATCCTGGCCAAGAGCCAGTACAGGCAGCCAATGCTGTTCCTCCCCTTGTTGTTTGCTGGGATGCCGATATCAACGTA
TCGCATGGGAGAGTCAGTGTCACAGAAGGCAATGGTAGGGATGTTCCCCAGAGCAGACTCCTTGATGGGCTGGTGGTCAGTCCTTGGGTCGGTGAGGATG
AGCAGGCGGGGCTCGCTGAAGGAGGTCTGCATCTGGTTGGTGAAGGTTCCAGGGGTGTGCCTCCCGGCGATGGCGTTGGCGCCTGTGTGCTGCGCGAACT
TGAGGACGGCGCGTTGGCCGTAGGGGCGGGCGGACTGGACGATGATGTCCTGGGGGTTCTCGATGGCGACGATAACCCTCGCCGCGAGCTGGAGCTTCTC
CCATGTCTTGCCCAGATTGATGATGTAGATGCCGTCGGAGCGGCGCTTGTAGGCGTAGCGCTCCATCTGGAAGTCGCAGTTCTTGGTGCCGAGGTGGACG
TCGGCGGCGAGCATCATCTGTATGTCCTGCTCCTTCTGGGACAGCGCCCGCGGGGCCTCTCCAGCCGCTGCCGCCATGGTTGGTCGGGGACTCGAGCGTC
CGGGGGGCGCCGCGAAGGGGAGGAGGAGGAGGGAGGGATGTGAGCGGCGGCGCGAGCGGGGAGAAGCG
page-top