Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24849  (registered. 2007)
Contig Information
Length 761 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Protein H2A.7; AltName: Full=wcH2A-4; AltName: Full=wcH2A-10 >gi|536892|dbj|BAA07278.1| protein H2A [Triticum aestivum] >gi|536896|dbj|BAA07280.1| protein H2A [Triticum aestivum]
Score 444
Evalue 2.95007e-42
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24849
TACCCACACCACACCGCTTCCGCACTTCCTCCCGGCGCCTCGTTTTCCATTTCACAACCGCGGATCCCCTCCAAGCACTGTAGACATGGCCGGAAGGGGC
AAGGCGATCGGCTCGGGCGCTGCCAAGAAGGCCATCTCCAGGAGCTCCAAGGCTGGGCTCCAGTTCCCCGTCGGCAGGATCGCGCGGTTCCTCAAGGCCG
GCAAGTACGCCGAGAGGGTCGGTGCCGGCGCCCCCGTCTACCTCGCCGCCGTGCTCGAGTATCTCGCCGCTGAGGTTCTGGAGTTGGCCGGGAACGCGGC
GAGGGACAACAAGAAGACCCGCATCGTGCCGCGCCACATCCAGCTCGCCGTCCGCAACGACGAGGAGCTCTCCCGCCTGCTCGGCATGGTCACAATCGCC
AGCGGTGGTGTCATGCCCAACATCCACAACCTTCTGCTCCCCAAGAAGGCCGGAGGCAGCAAGGCCGTGGCTGCCGACGACGATAGCTAGATGACGACTC
CTCGGTGGTCGTGGGTGCTCGGCTGTATCCAGTTCTGTGTAGTAGCGTGTTCAGTTAAATGTTGCCTAGGTGTTGCGTTTTACTTCTAGGATGTTAGTAC
TACTATTAGTTTCTGAATCTGTGTGCTTGTACCGGTGCTAAACTAGGTGTGGACAATGGTTACATCCTGTGTAAGTCGTTGCTAGTTCGTTCTATAAAAG
TTGCACCTATGGATTGCTTACTTGCGAATTTCTACCACTCTGTTCTTGGTTGAAAAAAAAA
page-top