Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24846  (registered. 2007)
Contig Information
Length 1416 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin precursor [Hevea brasiliensis]
Score 934
Evalue 2.16766e-165
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24846
TTTTTTTTTTGCCCGAAAGTTCATTTATTCATTACTTAGATGTTACTGTACCAGCAACTTCGTAAACCAAACACGTAACAGTGACTCGATAGTTCATTAA
ACCAACATAGGACTGATGCGAACAATGAAACAGTTCAAATGAAACGGACACAACGAACGACCAAGCATAAACCAGCAGGTCCAACGCCAGGGCAATTACT
GACCACCACGGAGGCGGAGCACAAGGTGGAGGGTGGACTCCTTCTGAATGTTGTAGTCCGCAAGGGTGCGGCCATCCTCCAGCTGCTTGCCGGCGAAGAT
CAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGTCAATGGTGTCAGACGACTCCACCTCAAGTGTGATGGTCTTG
CCGGTGAGGGTCTTCACGAAGATCTGCATGCCACCACGCAGACGCAGGACAAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCCGCGAGGGTGCGGC
CCATCCTCCAGCTGCTTGCCTGCGAAGATAAGGGCGCTGCTGGTCCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTC
AGAAGACTCCACCTCAAGCGTGATGGTCTTGCCCGGTGAGGGTCTTGACGAAGATCTGCATGCCTCCCCGAAGGCGGAGGACAAGGTGAAGGGTGGACTC
CTTCTGGATGTTGTAGTCAGCAAGGGTACGGCCATCCTCCAGCTGCTTGCCAGCAAAGATAAGGCGCTGCTGGTCCGGGGGGAATGCCCTCCTTGTCCTG
GATCTTGGCCTTGACATTGTCAATGGTGTCAGACGACTCCACCTCAAGTGTGACGGTCTTGCCGGTGAGGGTCTTCACGAAGATCTGCATGCCACCACGC
AGACGCAGGACAAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCGAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCAAAGATGAGGCGCTGCT
GGTCCGGAGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCAATGGTGTCGGAGCTCTCAACCTCAAGGGTGATGGTCTTGCCAGTGAGGGT
CTTGACGAAGATCTGCATGCCACCACGCAGCCGCAGGACAAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCAAGGGTGCGGCCATCCTCCAGC
TGCTTGCCAGCAAAGATAAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACGTTGTCGATGGTGTCGGAGCTCTCAACCT
CGAGGGTGATGGTCTTGCCGGTGAGGGTCTTCACAAAGATCTGCATCTTGAGGCGGCGGGGGAGGAGGATTCGACGAGCCTGGGGTCGATCGGAGACGAG
ATTGGCTGGGGATTCG
page-top