Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24832  (registered. 2007)
Contig Information
Length 1481 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein S9 [Zea mays] >gi|195625718|gb|ACG34689.1| 40S ribosomal protein S9 [Zea mays] >gi|219885117|gb|ACL52933.1| unknown [Zea mays]
Score 922
Evalue 3.12045e-97
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24832
CTCGAAAGAAGGTTGATTCCTATGAGCTATCAGACAACCACCCCAACAGAAGCAATTGAAGGAGGATTCCAGGTCATAGTCAAGAACATTTTTAGATAAC
TTTCATCACGACCAAATAGCTCCAAACATAAAGCAGTGCATACATGCTAACAACAGTGATAAAGTGACAAAATGACAAGAGGATAACCCATGAAAGTCTC
AGGCCTCTCAGCTAAAGTACTCATAACACCAACATTTGATAAATATAAGGTGATAGCTACTAGTTCCTCATTCCTCTTCCTCGTCACCACCGGCGTCACC
GCCACCACTTGCCTTCTTCTGGTTCTTTCTCTTCACCCTGCCTGCAGGGCCTCCACCGAATGGACTTGTCAGTGAGAAGTCGATGTGCTTCTCAGATTCA
ACCCTCACCATGAACGAGGGGACATTGACGATCTGCCTGCCAACCCTGATGTGGCGTTGCCTGATCAAGACACGGGCATGGTGGATGGATTTTGCCATGC
CAGCCTTGAAGACAAGAGTCTGAAGGCGCCTTGCAAGGAAGTTCTCAGCAGTCAGGGCAAGGACGTAATCAAGCTTATCCTGGCCCTCAGCAAGGAGACC
ATAGCGGTTCATGCGACGGAGAAGGGCCGCGCCCTCAAAGATACGGCGGGGATTTTTCTCATCCAGTGTGAGCAAGTGTCTTGCAGCATTACGAATCCTG
CTCAGTGCATACTGAACCCTCCAGAGCTCACGCTTGCACCTCAGTCCATATTCACCGACCAGCTTTAGTTCTGCATCAAGACGCTCCTTCTCATAAGGAC
GCCTTGGTTTCTTGAATGTCTTACCATAGTTGCGGTAGAAGTTGACGTGCACCATGGCTGGAGCTCTCTCCTCTTTCTTCCGCTGCCGCCGCCGCCGCCG
CCGCTCTGTGGTCGAGTTGATCGCAAGACCCGTCTCCTGGATGTGGTTTACAATTCGTCAAACAATGAGCTTGTGAGGACTCAGACCCTTGTCAAGAATG
CCATTGTGCAAGTTGATGCTGCCCCCTTCAAGCAGTGGTNCCTGACTCATTATGGAGTCGAAATCGTTANGAAGAAGAAAGCTGCTGCAGCTGCCAAGAA
GGNACCTGCTGAGGGGCAAGAGGCTGAGGTTGCTGCTGCTGCCACAGAGGAAGCAAAGAAGAGCAACAATGTCCAGAGGAAGCTNGAGAAGCGCCAGCAG
GGACGTACACTGGACTCGCACATTGAGGAGCAGTTCANTGGTNGAAGNCTGNTGGCCTGCATTTCGTCTCGCCCTNGNCAGTGTGGCNGANCTGATGGGT
NCATCNTGGAGGGCAAGGAGCTGGAGTTCTACATGAGGAAGCTCCAGAAGAAGAAGGGCAAGGGTGCCACAGCTTAGGCTGAAGAGNTGNTGCATGTTAC
TCGTTGGATTTTNNTNGATGTTGCGTCCATGTCATGTTTGCAGACATACTGAACACCATTTTCTGTAAACCGGTTCGAGTC
page-top