Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24826  (registered. 2007)
Contig Information
Length 900 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 6.52286e-69
Total Hit Count 399
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24826
TTTTTTTTTTAGGTTCAAAAGCATAATATAATACCATTAACCCAAATGGTTTAACAAACTCTGCATAAGCATCTCTGATTGAAACATCCAACAGAACAAA
CACGATATGATATTTAAGGTATCTGACACGCTGACACAAACAAGATATTGCACAGAAAACAGTTCTGAACTTCTGATGTTCCAAAATTAGGCTAACCCTT
GATATTACCAGAAAGATAAAGCTTCTTATCAGACCTTCACTTCTTGGCCTTCTTAGGTGCAGCTGCTGCCTGAGCGGGAGCTGCAGCCGCTGGTGCTGGT
GCATGATCTCTCGGGCCCTGAGCCAATCTCTCCTCCCTCCTGGCAATCTTCCTCTCCCTGCTTGCCTTGCTCTTGGCGCGCTTGGCCTCAAACTGGTCAG
AGAGGGTCTTCTCTCTTGCCTTCTCAGCCTTGGACTTGTGGATACTCTCCATGAGGACCCTCTTGTTCTTGAACATGTTACCCTTGACCTTCAGGTACAT
GTCATGGTACATGTGCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGCAGAAGGCGCCTCAGGACACGCATCCTCCGCATCCACAGGATCTTGGTGGGG
AGCCTAGCCTCCCTGGTACCCCTACGCTTACCATATCCAGAGTGACGGCCCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGAGACCTGGAGTGGATCT
TCTGAGGCTTCCTGATGATGAAACCATCCTTCACCAGCTTCCGGATATTCTGCCGGGAGTTGGCCATGGAGATCTCGTTGACCTCATTGGGGTCGAGCCA
GACCTTGCCCTTGCCGCACTTGAGGACGCTCGAGGCCAGGCGCTTCTGCAGCTTCAGCGACACCATCTTCGCCGCCGCTCTCCTCCTCCTCCGGTCTGGT
page-top