Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24817  (registered. 2007)
Contig Information
Length 1244 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 42
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-gliadin [Triticum aestivum]
Score 392
Evalue 7.00239e-36
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24817
TAGTAGAGTGCATCATTAAAGCCAAGCAAGCAGTGGTCAATACAAATCCATCATGAAGACCTTTCTCATCCTTGCCCTCCTTGCTATCGTGGCGACCACC
GCCACAACTGCAGTTAGAGTTCCAGTGCCACAATTGCAGCCACAAAATCCATCTCAGCAACAGCCACAAGAGCAAGTTCCATTGGTACAACAACAACAAT
TTCCAGGGCAGCAACAACAATTTCCACCACAACAGCCATATCCGCAGCCGCAACCATTTCCATCACAACAACCATATCTGCAACTGCAACCATTTCCGCA
GCCGCAACCATTTCCGCCACAACTACCATATCCGCAGCCGCAATCATTTCCACCACAACAACCATATCCACAACAGCAACCACAGTATCTACAACCACAA
CAACCAATTTCGCAGCAACAAGCACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAATCCTTCAACAAATTTTGCAACAACAACTGA
TTCCATGCAGGGATGTTGTCTTGCAACAACACAACATAGCGCATGCAAGCTCACAAGTTTTGCAACAAAGTACTTACCAGCTATTGCAACAATTGTGTTG
TCAACAACTGTTGCAGATCCCTGAGCAGTCGAGGTGCCAAGCCATCCATAATGTTGCTCATGCTATTATTATGCATCAACAACAACAACAACAACAAGAA
CAACAACAACAGTTGCAACAACAACAACAGCAGCAACTGCATCAACAACGACAACAACCATCGAGCCAGGTCTCCTTCCAACAGCCTCAGCAGCAATATC
CATCAAGCCAGGTCTCCTTCCAGCCATCTCAGCTAAACCCACAGGCTCAGGGCTCTGTCCAACCTCAACAACTGCCCCAGTTCGCGGAAATAAGGAACCT
AGCGCTACAGACGCTACCTGCAATGTGCAATGTCTACATCCCTCCACATTGCTCGACCACCATTGCGCCATTTGGCATCTTTGGTACCAACTGAGAAGAG
AAGAACTCTAGTACTAGATATATGAAACACCGTTTTCTTAGTCCATGGTTTGGTCGTTGTAGCAGTGAAAAAATAAAGTGACATGCACTATCATGTAAGA
ACCCGAACTATACTAGTTCAAACTTGGGAATAAAAGACAAACACATGTCTTGTCTACATATGATTGTTTGTTTGAGTTCCATTCATGTGCCATCACAAGT
TCACCCCTAATTATATATATTATGCATTAAGTAGAAAAAAAAAA
page-top