Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24815  (registered. 2007)
Contig Information
Length 586 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 7
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Acyl-CoA-binding protein [Panax ginseng]
Score 367
Evalue 1.41218e-33
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24815
CTAGCCTCGCATCGAATCGATCGTTCTTATCGCCTCGAACGTATCGAAGCCGAGGAGAGCGGAGCAGCCGACGAGCCGATCGACATGGGTCTGCAGGAGG
AGTTTGAGGAGTACGCGGAGAAGGCCAAGACGCTGCCCGACACCACCACCAACGAGAGCATGCTCTGCCTCTACAGCCTCTACAAGCAGGCCACCGTCGG
GCCCGTCAACACAGCCCGCCCCGGAATGTTCGACCTTAAGGGCAAGGCCAAGTGGGACGCCTGGAAGTCCGTCGAAGCGAAATCCAAGGAGGAGGCGATG
GCGGACTACATCACCAAGGTGAAGCAGCTGCTCGAGGAGGCTGCCGCCGCATCCGCTTCTTCCTAGGCCACAGAACCTACTTTTATCCATGGTGGTGCAG
ACATATGTGCCAATAAACACAAATAAATTTGAAGTGCTATCTGTCTAAGCTTATCGTCGTATTGGGTGTAATTACGTTGAACAAGCCCCGCCTGTGATAT
TTGAGTTTACGCCATGATTGATTCATGTATGTCTTGTCTTGTTATAAGATGGTTTTTCTTTGGGGAATCACGGGAGAAAAAAAAAA
page-top