Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24812  (registered. 2007)
Contig Information
Length 797 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 2.75143e-33
Total Hit Count 63
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24812
TTCGGCACGAGGCATTCCGATCCGTTGGCTTCCTGTTCATACATTCTCCCCTCCCGGCGCCGCCTCCAGCCTAGGGTTTCCTCCCGCCGTCCGCCGCCAT
GGCTCGCCGCAGCGGAGGAGGAAGGTCTTCCCGCCCTGCTCCACGTGCTGCTCCAGTGAGAAACCCACCAGCGCCAGCCCGTCAAGCTCCTCCACCTGCT
ACTACCCAGAATAGCGGTGGTGGTATCATGAGTGGAATTGGGTCCACCATTGCTCAGGGCATGGCTTTCGGTACTGGCAGTGCCATGGCGCACAGGGCTG
TTGATGCTGTGATGGGTCCCCGCACCATTCAGCATGAGACTGTTGTCGGTGAGGCTGCTGCATCTATGACTCCAATGGACAATGCTGCTGATGACAAGTG
TGGCAACCCTTCCAAGGCCTTCCAAGATTGCATCAACCACTACGGAAGCGACATCAGCAAGTGCCAGTTCTACCTCGACATGCTGAACGAGTGCCGCCGT
GGAGGAGCAGGAGCTGGTGCAACTCTTTAAGCTACTATCTTTGCTTGATTGCGGCTTAATTGGTCGGAACCTGTTTTCAGTCATGATGATGATGATATAT
ATCTCCTAAATAATTCATTGGCAATATTATGAACCTATGCCACAGCTTATGTCTATTACCTACCCTAGTTTGTGGTCTCTGTTGTCCTGGGAGTATTTCC
TTGTATTGATGTTGGAATTACCTTCATGGCAGTGGGTTTATAAATATGGAGTTTAAATATGGTGCGTTGCAACTTCATTTTTTGAGCAAAAAAAAAA
page-top