Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24788  (registered. 2007)
Contig Information
Length 912 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 10
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein S7 [Triticum aestivum]
Score 980
Evalue 2.87124e-104
Total Hit Count 312
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24788
AATCGTACAATCTTGGTCTTACATGATAGCAACGCTCAATTAGAAATGACAATCAAGTGCAACAAGATAACCGAGCAGAGGTTCATAATTTAAATGCTCA
AAACTTTAACATTGTTCACGTTCATTGCCAATCTCCATCAAACTTCCTAACCCCAGATCGTTAACAAAACTATGTTTCTGGAATACATTGATAGCACAAC
TAACTGAGACCTCGACCAAAACATTCGGATCAGAAAGATATGAAAATGGAGACATAAGGCATGGATCTTCAGGCGGTTTCAGTCACAGGGTACTCAAAGA
CAACGTCTTTCCCACAAAGCCTGCGGTAGACTGCAGAGAAGGTCTCCAGCTTGTATTCAGTGTTGTTGCGCTCCTTTGGGTCCAAGTAGATCTTGATGAC
CTTGGCACCATCCAAACGGTATCTGACACGCTTCCCCACAATCTCAGCTGGGTACACGACATCCTCCAAGATACCATCATGAACAGCTGTCAGGGTCCTG
GTGCGAGGGCGCTGAACAGCAGAACCCTTCTTGGGTGGCCTCACAATCCTTCTTGTTGCAACAAAGACAACATCCTTGCCGCTAAACTTCTTCTCCAGCT
CCCTGACGAGCCTGACATGGATCTTCCTGAAGGGCTTGCGCAGACGGTACGGCACATGGATCACCACGGCCTTCCTGTTGCCAACAACATCCATCTGGAT
TGCAGTGTTGATGTACAGGTCCTTGAGGTCGCTCTTGAGCTCCTGGTTGCCATTCTCCAGGTCAAAGAAAGCCTGCGCAACGGTGTCCTCGAACTCGGAG
GGCTCGACGCCCTTGTCCTTCTGGATCTTCTTCCTGGCGGTGTACATCTTGCTTCCCTTTCGCCGGGCCCTGCGCGCGAGGAGACGAGGGAGCAGAGAAG
TGGAGGCGCCGG
page-top