Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24782  (registered. 2007)
Contig Information
Length 670 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 10
Wh_MS Seed DPA5 of DT3DL CS wheat 14
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Babesia bovis T2Bo] >gi|154796873|gb|EDO06053.1| hypothetical protein BBOV_II000930 [Babesia bovis]
Score 79
Evalue 4.77613
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24782
TTTTTTTTTTGAACACCACAACAGATTAACAACACGGCTGAATATAGATCTCTGATAACAACAGATAAGAGTGGCGATAGAGTGCCCTTACATCCCACAT
GCAACCACCGAAATTAGATCCCACAGAACCTGGATCCCCATTGTACATACAGTAGTGATCTTACATAACACACAAGCCAGGAATTACAGAGTACACCGGC
TAGTTAAAACATGCATGATATATAGAGTACTAGTAGATAGTAGAACTTGCAGGTGCAGTAGTAGATAGTAGAACATGCGGTGCAGGATAGATATTCCAGT
CATTCACCATTGAGCCATCTCCCTTCAACCGAGCCTATGGACCCCAAGCAAAAAGGTGAGTGCTCCAAGACTGAAGCCAGCACCACAGGCTAAGGCCTCG
TCCCTGCGCCTCTTCCTGTGTTTCTCTACAATCTTGTCCAGTGCCCGGCGAAACTCTGGGCCGAAGCCGAAGCGGTCGAAGTCAGCATCAGCAGGTGCCG
GAGCACGAGAAGAGACGCGAACCCGCTGGACAGCGGCGGGGATCTTCTGCTTCAGCTTGGCGGCCATGGTGCGCAGCGCCATAGCCATACCCTCCACCAA
CCCAAGCAGATCTGGACGACGGCGGCTAGGGTTTCCTTCTCTCGATCTCCAACACGCGAGCGGCACGAGG
page-top