Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24760  (registered. 2007)
Contig Information
Length 956 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 4
Wh_VSCB Liquid cultured tissue 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|7248415|dbj|BAA92738.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|24413953|dbj|BAC22205.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|113594653|dbj|BAF18527.1| Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|125553806|gb|EAY99411.1| hypothetical protein OsI_21382 [Oryza sativa Indica Group] >gi|125595832|gb|EAZ35612.1| hypothetical protein OsJ_019095 [Oryza sativa (japonica cultivar-group)] >gi|149391053|gb|ABR25544.1| 60S ribosomal protein l13-2 [Oryza sativa (indica cultivar-group)] >gi|215678596|dbj|BAG92251.1| unnamed protein product [Oryza sativa Japonica Group]
Score 806
Evalue 4.64533e-84
Total Hit Count 315
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24760
TATTGCTTCCTAACATCCTCTAGCATTAACCCAAAAACACAGGCACTCATACACAGAAAGTGATAAGAGACACAAGGATAAAAATCCAAGGACACTCATA
GGATAAGATTTGATAGCAGATCATGCAAATAAGTATATCAGGTATCAAACAAGATGTCCGAGAAGGCCAAAACACAAATTTAGAAACTAGCACTTGATAA
CAACAGAACCCACTAGCTGCCTTAAGCATATCTCATCACTTCTTCTCCTCCTTCTCCGCCTCGGCAGCCTTCTTCTGCCTGGCTCCCAACTGGCGCTGGT
TCATCCTCTCGACGCGGAGCTTGCCATAGGCCTTGAACTCCTTCATCTCCTCTGTGACCTTCATGACCTCGACTGAGCGCTTCTCGCCACGGGCAATGGG
CATGTAGTCGCCCTGGACCTGTGTGGCATTGGCAAGCTCCTCCGGAGTAGAGTCACCAGCCTTGACCTTGCGAGCACGCCTTGGGAAGATGACAAGCTTG
GCCTTGTAGGTCTTGAGCCTCTGGATGTTGGACTGCATACCCTCAAGCGACCTGTTCTTGCGGCGGTGGTCCACAGAAATGCCAATGGTCGGAGCGAGCT
TCTTTGGGATGCCAGCGGACTTAAGCTCCTCAAGGGTAAATCCCCTGCCAGCCCTGGCCTTCATGTTGTACTTGCGGGTCTGGCATTGCACAATGGGGCG
AAGAGGTCCAGAGGTAGGACGGGGGAAGATCTTCACAGCCTTCTTCTGGCGAGCGATGCGGCGCCTCTGCTTGCGGGCGGGCTGGTTGAACCACGTCTTG
ACATAGTTCTGCCAGTGCTTCTTGAAGTGGCCGTTGGGGATGACGTTGTTGTGCTTCACCATCTCGCCCTCCTCCTTACCTGGGGACGACGGGGCGGCGG
CGGGGGCGGCGCGGGGAAAGGCTAGGGTTTTGCGGGGGAGTGGAGCGGCGGCGCGG
page-top