Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24759  (registered. 2007)
Contig Information
Length 1002 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 10
Wh_V4816 Shoot grown under cold condition for 16days 12
Wh_V483 Shoot grown under cold condition for 3days 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR80 [Triticum aestivum]
Score 160
Evalue 4.08695e-09
Total Hit Count 396
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24759
TTTTTTTTTTGATGTTGAACTCACTCTGGTTTCGTTATTTGATAATGGAACCGGGTGGCTTTGGCCCTCCTGATAGTCAAAAAATAGATAGCCCAAAAAA
AAGAACAAAAAGGAAATTTGCACGACAGAGAGTGTAAACAAACGTAAACAGTGAACACATTTCCGTGAAAACTTAAAGCAAAGATACATTCGCTCCTCCA
ATGACCAAGTGAGCTAGGTGAACTAGACTCGATCAATTCATATACGGTGGAGTATTATTCTGCGAAGGTAGCGGTCGTGGGCACACCGGGCTTAGTGCTG
TCCAGGCAGCTTCTCCTTGACCTTGTCCATGAGGCTCTTCTTCTCGCCGGTCCCGGCTGTGCCGTGTGTCCCAGTGCCAGTCGTTCCGGTGTGTCCCTGC
TGCCCAAAGGTGCCGCCGGTGGCCGTGGTGTCATGCATCTCCGTGCCGGTCATTCCAGTGTGTCCCTGCTGCCCGTGGGTGCCAGCGGTCTGCTGGTGGC
CACCGGGGAGCTTCTCCTTGATGTTCTCCATGATGCCTTTCTTCTCGCCGGTGCCGTGTCCCTGGTGCTCCATCTTGCGCTCAACCTGTCACTCGGGAAA
TCTACTAGCTAGTGCTGCTGTTTACTTGTCTTGGTTGCAGAAGCCCAAGCCGTATGGAGAGGAGACTCAGGCTTCGTATGGTGGTGGGTATGAGAAGCCC
AGCTACGGCGGGGGGAACTATGGCCGCAAGAAGCAGGATGACGACTCTGATGATGAGAAGAAGAACCGTTACGCGAAGCGCGATGACTCGGATGATGAGA
AGGAGCGTTACGAGAAGCACCACCACCACCGCCGCCACAACTACGACGACTAAGCATCCAGCATGGTCTTGACCTGCTGCCATCGCCCCCACATCTCGCT
ACTACACGAATAAAGATTGGTCTTGTTTCCCTTGTTGGTGCCGGATCATTCCCCTCTTTTATGAACTTGTATGACTGCAACCTAAAGTGTGCTATGTGGG
TG
page-top