Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24758  (registered. 2007)
Contig Information
Length 2703 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Pyrophosphate-energized vacuolar membrane proton pump; AltName: Full=Pyrophosphate-energized inorganic pyrophosphatase; Short=H(+)-PPase >gi|6012172|dbj|BAA02717.2| inorganic pyrophosphatase [Hordeum vulgare subsp. vulgare]
Score 3665
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24758
CGTCCACCCCTCACCCGCCGCCGTCCCGTCCGTTCGGTCCGTTAGGGTTTCGTCGGCCATGGCGATCCTCGGGGAGCTCGGCACCGAGATCCTCATCCCC
GTCTGCGGGGTCGTCGGCATCGTCTTCGCCATCGCGCAGTGGTTCATCGTCTCCAAGGTCAAGGTCACCCCCGGCGCCGCCGCCGCCGGCGGCTCCAAGA
ACGGCTACGGCGACTACCTCATCGAGGAGGAGGAGGGCCTCAACGACCACAACGTCGTCGTCAAGTGCGCCGAGATCCAGACCGCCATCTCAGAAGGAGC
AACATCATTCCTTTTCACCATGTACCAGTATGTTGGTATGTTCATGGTCGTCTTTGCTGCGGTTATCTTCGTCTTCCTTGGGTCAATTGAGGGATTCAGC
ACAAAGGGCCAGCCCTGCACCTACAGCACGGGCACCTGCAAGCCAGCTCTCTACACCGCCCTCTTCAGCACTGCATCTTTCTTGCTTGGAGCCATCACAT
CTTTGGTGTCTGGTTTCCTTGGGATGAAGATCGCCACATACGCCAATGCTAGGACGACCCTGGAGGCAAGGAAGGGTGTTGGGAAGGCATTTATCACTGC
TTTCCGCTCTGGTGCAGTCATGGGCTTCTTGTTGTCATCAAGTGGGCTTGTGGTTCTTTACATCACCATCAACGTGTTCAAGATGTACTACGGTGATGAC
TGGGAAGGTCTTTTTGAGTCCATCACTGGTTATGGTCTTGGTGGGTCTTCCATGGCTCTATTCGGAAGAGTTGGTGGAGGTATCTACACCAAGGCTGCTG
ACGTGGGTGCTGACCTTGTTGGCAAAGTTGAGAGGAACATTCCTGAAGATGACCCAAGGAACCCAGCTGTAATTGCTGACAACGTCGGTGACAATGTTGG
TGATATTGCTGGGATGGGATCAGATCTCTTTGGTTCATACGCAGAATCGTCCTGCGCTGCTCTTGTTGTTGCTTCTATCTCATCTTTTGGAATCAACCAT
GATTTCACTGCGATGTGCTACCCACTGCTCGTGAGCTCTGTTGGCATCATTGTTTGCTTGCTCACCACCCTGTTTGCGACTGATTTCTTTGAGATCAAGG
CTGCAAGCGAAATTGAACCTGCTCTGAAGAAGCAGCTCATCATCTCCACTGCTTTAATGACTATCGGTGTTGCGGTGATCAGCTGGTTGGCTCTCCCAGC
TAAGTTCACCATCTTCAACTTCGGTGCTCAGAAGGACGTGTCCAACTGGGGCCTGTTCTTCTGTGTGGCAGTTGGTCTGTGGGCTGGTCTGATTATTGGG
TTTGTGACCGAATACTACACTAGCAATGCCTACAGCCCTGTGCAAGATGTTGCCGATTCCTGCAGAACTGGTGCTGCCACCAACGTCATCTTCGGTCTTG
CCCTTGGTTACAAGTCAGTCATCATCCCAATTTTCGCTATTGCTGTCAGCATCTACGTCAGCTTCTCTATTGCTGCAATGTACGGCATTGCAATGGCTGC
TCTTGGCATGCTTAGCACAATGGCAACTGGTCTTGCTATCGATGCTTATGGTCCCATTAGTGACAATGCTGGTGGAATTGCTGAGATGGCTGGCATGAGC
CACAGAATCCGTGAGAGGACTGATGCTCTTGATGCTGCTGGCAACACAACCGCTGCTATTGGAAAGGGTTTCGCCATTGGATCAGCTGCTCTTGTGTCCC
TGGCACTTTTCGGTGCCTTTGTCAGCAGAGCTGGTGTGAAGGTCGTTGATGTCCTATCTCCCAAGGTGTTCATTGGCCTGATTGTCGGAGCCATGCTTCC
GTACTGGTTCTCTGCCATGACCATGAAGAGTGTTGGAAGTGCTGCTCTCAAGATGGTTGAGGAGGTCCGCAGGCAGTTCAATACCATCCCTGGACTGATG
GAGGGAACTGCCAAGCCCGACTATGCCACCTGTGTCAAGATCTCCACTGATGCTTCCATCAGGGAGATGATTCCTCCGGGTGCTTTGGTCATGCTCACCC
CCCTCATTGTCGGAACCCTCTTCGGCGTGGAAACCCTGTCTGGTGTTCTTGCTGGTGCCCTTGTTTCTGGAGTACAGATCGCCATCTCTGCTTCCAACAC
CGGCGGTGCATGGGACAACGCAAAGAAGTACATTGAGGCCGGCAACAGCGAGCACGCGAGGTCCCTTGGCCCCAAGGGTTCAGACTGCCACAAGGCGGCC
GTGATCGGCGACACCATCGGAGACCCCCTCAAGGACACCTCAGGCCCGTCGCTCAACATCCTCATCAAGCTGATGGCCGTCGAGTCCCTCGTGTTCGCGC
CCTTCTTCGCCACGTACGGAGGTGTGCTGTTCAAGTACATCTAGAAGACTCGTCGAGCGGACTTAGAATCTACGGACACCATCACGAATAACTCTGCCCC
GCCCGCCCGCCGTTCGTATGTTGTGCGCTGCTGTTATTTTTGGTTCTTGTGTCATTATTCCAGGATTGCCGCAGTTTACCCCCACTTTCCCTTTGGCCTC
TTGGGTGTGTTACGTTAGTCTCACCATTACCGGCTTGTAGCTCCATGTAGTAGAAGAGAGAGACCAGATGTCCTCGGTCATTATTGGTATGTGTCTGGCA
AATTTTCCTCGTCCCGTGATGACGACGATAATGTTTGAACCCTTGAACAATGATATCATGACGATTGTTGCATCATCTCACCTATGCCGAGTCAAAAAAA
AAA
page-top