Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24753  (registered. 2007)
Contig Information
Length 1038 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar ATP synthase subunit E [Triticum aestivum]
Score 1141
Evalue 7.53635e-123
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24753
TTTTTTTTTTAAACACAATCCGACGGTGCTTTATTTATTATTCCTCAGAGCAAAGTTCGTGCAAATAGTTTGTGCTCGGCGACGATAATGAACAAATAGG
TAGTGTTTACATAAGAGGATGGAATACTTTAAACAATCAATGTTCGCAAAACCGGGCGGAGTTCGTTGCACCTGCTGGGGGTCAAACCAGCAGCCATTTT
ACATAGAAACAGCTGTACCATCACCAAAATACAAGTGCGCATTATGCCGCAACAAGAAGCTTCCGGATCTCTGGCAATTTCTTGCGGAAAACAACTTCAA
GCCTTGCATCAACTGTATTCTCAAACACAATCTTTCCATCTCGAGAAGCCAGCACAACACCTCCATGGCAAATCTGGCCGTGCTCATCGCCATGGCTCGG
AGAAGGTGGCAGGTAGACACTGTGGTCAACTAGTATCTCGGGCTCATGGACATCTGCTTTTGATGCATACTCATTCTTTGCTGAATGCAGTACAGATTCC
ACATTATGGTGATCTTCTTTGCGGCAGCGGAGCAGTACAGCTGGCTCTTTCAACCGAAGCAGGCCCTGAACAACGAGTTCTTTTAACAGATTCTTGTATT
CATGGTGGTTGCTGCTGATATTCAGGAGTTCCTTCATTGCATCCTCTTTCATTTTATTAACCAGGTCATCCTGGGCCTGAAGCACTTTGATGCGAGAAGC
ATTCAGCTGCATAGAGTACTCAATTTTCTTCCGAACATCAACCTGCTTCTCTTTCCGCTCATATTCTTGCCTGATCTTCTTTTTCTCAGCTTCAACAAGT
TGCAGCTTCTCAATGTTGAATTCCTCCTCAGCGGAGACGGAGATCTCGCCAGCCTTCTCCTCGGCCTCCTGGCGGATGAACCGCACCATCTGCTGGATCT
GCTTGGAGACATCGGTGTCGTTCATCGTGGCGTCGGCGGCGGCGGATCTGACGATTGTCCGACTGTGGGGCGCTGCTTCCGGCGACCACCGCGCGGGGGT
GTGGGAGGACACGACAGGAGGAGGGAGGGCGCGAGGGA
page-top