Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24751  (registered. 2007)
Contig Information
Length 739 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit non-specific lipid transfer protein 1 precursor [Triticum aestivum] >gi|94315723|gb|ABF14724.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 377
Evalue 1.65531e-34
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24751
TTTTTTTTTTGGAGCTGATCAGCTGAGTATACAATCCATATATCAAAATTACACATGGTACAAAGTACAGCATACTCGGGGAGTGGAGGAACAACCAAAC
TCGGGCCGGCCATGCAGAGCTGCTTGACGTACGTACTTCTCTCTCTCTCACGCAATGAGATAATATGAGAGCATTTGTTCATATATATGTGTGTGTGTGC
GTGTGTGTGACCTCAACATACTAAGCGTAGATCCAGCAACGATGGCGCAGGGGACGATGGCAACAGCGATGGCAGCAAGTGCTCGATCAGCGAATCTTAG
AGCAGTCGACCGAAGAGCTGATGGCGTAGGGGACGCTAACGCCGCACTTTGTGGGGATGCCCGCGGCCTTGCCAGCGTTGAGCCCAGCAGCAGCGCTCTT
GATACACTTGCACGCCACTTGCTTGTCAGCGGTGCTCCGGGCTGAGCTGGCTAGACTCCTAACGCCGCTGCAGCAGGCCGCAGACGGGTTGGCGCCGTTG
CCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGCTCACCTGACCGCACGATACGGCCGCCTCCGTGGCTGCGAGGAGCATAGCGGCCACCACGGCGA
CGAGCACGACCTGAGCAACAGCAGAATGGGCCATCACGATCAAGCTAGCTAGCACTAGTAGTGGTGGTGAGCTCAGGCAGAGATGATGAAATAGCTAGAT
TTGCTCCTCGTGCCGAATTCGGCACGAGGGAGAGAGAGA
page-top