Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24749  (registered. 2007)
Contig Information
Length 778 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216924 [Zea mays] >gi|194697072|gb|ACF82620.1| unknown [Zea mays] >gi|195621176|gb|ACG32418.1| cytochrome b5 [Zea mays]
Score 650
Evalue 4.01592e-66
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24749
TTTTTTTTTTCACATACACAACTAATCACATCAAATTAAGAATATGTATGTCTGAACATTCACCAGCGATATGGAAAATATAGCCAAGTATCTATCCGTT
TTTCCCGAGTCACGATTCAACAGCGGACGTCTTAGTAGAACCATAACGCAACGACGGGTCGAGAGCAGTTCCCAGATTCCATGACAGGACGGTGACGCTG
GTACAAAATATGCAAATCCCCACTAAAACTTATTCAGCTCTTGGACACTTCCGAATGACTGACTGACTGGTATAAGATGACGGTGCTAGACAGAGTCTGC
CTTGGTGTAGATCCGTACGGCGACGGCCAGGCCCAGTATCGCGAGGGGGACCAAGAACTGGAGGATCTTGATGACGAACTCGGGGGTCTTGTCCTGGTTG
TAGTGCGGCTGCTTGGGCGGCGTGTACTTGACCTTGGTGGGTATCGTGGTCGCGTCGATCTCGCCGACGTAGTACTCGTCCATCATCGCCCGGGCGGTTG
TGCTGTGTCCCACGTCCTCGAAGTCGTCGGTCGCGTCCTTGGCAGTTGAAGACAGCAAGACGTCGTCGCCTCCAGGGTGGTCATCAAGAAACTTGGTCAC
ATTGTACACCTTGCCGCCGATGACGAGCCAGCAGTCGTCCTTGGAGCTGTGCTTGGCGACCTCCTCCAGGGTGAAGAGCTTGCCACCGGACGACGACATG
GTCTCCTCCTCCTCCTCCTCCTCCTCCTCTCTCTGCTTCCAAGGAGTCAAGCGAGAGTGATGGGAAGGGTTGGATCCA
page-top