Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24744  (registered. 2007)
Contig Information
Length 1757 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fatty acid desaturase [Sorghum bicolor]
Score 1816
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24744
TTTTTTTTTTACTCAAAAAAGTTGCCCTTCCTTCGACGATCAGTTATTCCGCCATAAACACGAAATGGTCTACAACAACATGACACGGACGGGGGGAGAT
GACGCCAATGCAATGACAGACGCACACACAACACACGCGGCCATGTCCACGGCCACGGACACCGACGACGACAGCCGGCCAAACCTAAGCCGACGACTGG
AACACAGAGAAAAAGTAAAGACGGAACTGACCAAAGTCACGGACACGCTACTCTTCCTTGCACCACTCAGCTCTTCTAGCACTGGCACGGTAATAGTAGT
CTTCTTTTGTGCCCAAATGCCCTCTGCTATCTAAAGACTAACCATATGACTGTAGGTAGATGGATGGAATTACTTGGTAGGATCTCTTCTCTGAGTTCTT
TCTCGAGCACCGTTGATGGATCTTGACGGCTAGAACTTGTTGCTGTACCAGAAGACCCCCTTGCGGTCCTCGGGCTCGACGTAGATGCACTCCTTGGCCT
CGCGCCATGTGGCCTTGGCGACGGGGGTGGGGTCGAACTGGTAGTACTCGCCGAGGATGGGCTTGATCGCCTTGGTGGCCTCCATGGCGTGGTAGTGCGG
CATGGTGGAGAATAGGTGGTGCGCCACGTGCGTGTCCGTGATGTTGTGGAACACGCGGTTGAGGATGCCGTAGTCGCGGTCCATGGTGGCCAGCGCCCCC
CGCAGCCAGTCCCACTCCGTCGAGTCGTAGTGCGGCAGCGCCGGGTGGGTGTGCTGCAGGTAGGTGATCAGGACCAGCCAAGCGTTCACGATCAGCAGCG
GCACGCCGTAGACCCGCACCACCCACCAGAACCCGAACGACGACACGAGCTTCAGCAGAGCCAATGACACGGCCAGCACTCCGACGTCTGAGATGAAAAT
CTGGGCTCGCTCCCGGTCGTTGTAGATCGGGCCGTAGGGGTCGAAGTGGCAGGCGAACCGCGGGTACGGGCGGCCTGAGGCGTTGAGCGCCAGGTACAGC
GGCCACCCGAGGGTGAGCTGCACGACGATGTGCACCAGACGGCCGACGGGGTTGTTGTAGATGTAAGGGGTGTACCACGCCAGCGCCTCCTTCTGCTTGG
GGACGAACACCTCATCGCGCTCCAGCGACCCGGTGTTAGAGTGGTGGCGACGGTGGCTGTACTTCCACGAGAAGTAGGGGACGAGCAGCCACGAGTGGAG
CACCAGGCCGACGGTGTCATCGAGCAGCGAGTAGTCGGAGAAGGCGTGATGGCCGCACTCGTGCGCGATGACCCAGACGCCGGTCATGACGCAGCCCTGC
ACGACCCAGTAGAGCGGCCAGGCGCCCAGCTGCAGCACGCTCGGGAGGGTGGGGATCCAGACCAGCGCCGCGTACAGCAGGGCCGCGACGATGACCAGGT
CATGGACCACGTAGGAGAAGGACTTGATGATGGAGCGCTGGAAGCAGTGAGGCGGGATTGCCTTCTTGATCTGACCCAGCGTGAACGGCGGCTTGTCCGT
CGGCGAGCGCTGGTAGGCTGCCCCGCCGTTGGCGCGGCCGAGCTGCTCCTGCTTCTCCCGCTCCTTCTCCGTCATCCTGCCGCCGGCACCCATGATGCTG
ATAGGGGTGGTGGTCGAGGCGGCGGGAGCGGGGCAGATCGGGCCGGCGGACACCACACACGCGAGCGCGCGCACCCTCTTCCCTCTCCGGCGCCTCTGCT
CCTCTTGTTGACGGGACGAACGAGTGGTTTGTGCGGGGGGGAGGAGCCTCGTGCCGA
page-top