Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24734  (registered. 2007)
Contig Information
Length 840 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|32352148|dbj|BAC78567.1| hypothetical protein [Oryza sativa Japonica Group] >gi|42407865|dbj|BAD09007.1| putative mitochondrial F0 ATP synthase D chain [Oryza sativa Japonica Group] >gi|113624019|dbj|BAF23964.1| Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|215695541|dbj|BAG90732.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201320|gb|EEC83747.1| hypothetical protein OsI_29610 [Oryza sativa Indica Group]
Score 697
Evalue 1.64167e-71
Total Hit Count 94
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24734
ATCAAGAGTCACACAGCCCTAGCAAGTCTAGCAGATCCAGAGCCGAAGATGAGCGGGGTGAAGAAGGTGACGGACGTCGCGGCCAAGGCCGGGAAGGCGA
TCGATTGGGACGGCCTGGCGAAGATGCTCGTCTCCGACGAGGCCCGAAAGGAGTTTGCCAACCTCCGCCGCACCTTCGAGGACGTCAACCACCAGCTCCA
GACCAAGTTCTCCCAGGAACCAAAGCCAATTGACTGGGAATACTACAAAAAAGGAATTGGATCGAAAGTTGTGGATATGTACAAGGAGGCTTATGATAGC
ATTGAGATCCCAAAGTATGTTGACACTGTCACTCCTGAGTATAAGCCAAAGTTTGATGCTCTGTTAATCGAAATGAAGGAAGCAGAGAAGACATCTCTGA
AGGAATCAGAGAGGATAGAGAAGGAGATTGCTGAATTGAAAGAGTTGAAGAAAAAGATCAGCACAATGACAGCAGACGAGTACTTTGCGAAGCACCCTGA
ACTCAAGAAGAAGTTTGATGATGAGATCCGTAACGATTACTGGGGATACTAGATAACGGCGAAAGTCCAAGTTCTTTTACTAGAACATTCAATAATACTT
CTTTGTCCCTCTGGAATCTCATCATCCAAACTTGGGTGAATTCCATAACATGCGGACTGGGCTTGTTGAAATTCCGACATAACTCAGATCTTTGTGCTTT
CTGTTGGACCTCATCATTTTATGGGTCGCCAGCTTATTTCATTGAAATTTTGTCTTGTGTTTAACTTTGCTCCTTTGTACAAGAGGATTTCTGCTATGGC
TTGATTCCAACATGTACCTTGTCGTTTGTCAAAAAAAAAA
page-top