Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24729  (registered. 2007)
Contig Information
Length 1736 bp
Clones 38 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_OKCS Seed DPA5 10
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|19569141|gb|AAL92029.1|AF486280_1 cytosolic 6-phosphogluconate dehydrogenase [Oryza sativa] >gi|7363280|dbj|BAA93024.1| putative phosphogluconate dehydrogenase [Oryza sativa Japonica Group] >gi|113594626|dbj|BAF18500.1| Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|125595798|gb|EAZ35578.1| hypothetical protein OsJ_019061 [Oryza sativa (japonica cultivar-group)] >gi|215686886|dbj|BAG89736.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2327
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24729
AATGGCAATGTCTTCCCACCAGGGTTCATCAATCACATGGAAGTAGTGGAGACTGGAGAGAATATGTGATCTCCTTGTAGAAAATAAATACAGGACTCGT
TACTCAAATGATAAAAATTAAACAGCGGTTCCTCCCCTACAGGAAAAGGACTCATGACTGGCAGCAACAAAGGATACCAAGAAGACGAAACGTGATGGGC
CGTCTCTTGGTAGAGCAGCAGCAGCATCTTAGATCTTCGAGTTGGCGATCTTGTACCACTCGGTGTGGAAGGAGCCGGGCATGTCAACCCTCTCGTAGGT
GTGCGCCCCGAAGTAGTCCCTCTGGGCCTGGACAAGGTTTGCAGGAAGCCTGTCCCTCCGGTAGGAGTCAAAGTAGGCCAGACTCGCGGACATGCCAGGG
GTGCTGACGCCGTTGTTGATGGCGAGGCAGACGACCCTCCTCCATGCGGCTTGCCTGTCCATGATCTCCTGCGCGAACTCGGGGTCGATGAGGAGGTTGG
CGAGCTCACCGTTCCTGTCATAGGCCTTCTTGATGCGGTCGAGGAAGCTGGCGCGGATGATGCACCCGCCCTTCCAGATCCTGGCCAGCTCGCCGAGGTT
GAGGCCCCATCCCTTCTCCGTGCTCTTGGCCTTGATGATGTTCATGCCCTGGGCGTAGCTGCAGATCTTGGAGGCGTAGAGGGCTTTCCTCACATCCTCG
ATCAGCTGTGCCTTGTCGACAGTTTCACCACTGGAGTAGTCACCCTGGAAGATCTTGGAAGCCGCGACACGCTCATCCTTCAGCCCGCTGAGGAACCTGG
AATCCAAGGACGCCTCAATGGTAGGAGCAGCCACAGAGAGCTCAGCAGCCTGCTGCACTGTCCACTTCCCAGTTCCCTTCATCCCGGTCTTGTCCAGGAC
CTTGTCGACCAAGTAGCCTTCACCCTGGTCATCCTTGATGCTGAATATATCAGCAGTGATCTCGACCAAGAAACTGAGGAGCTCACCCTTGTTCCACTCG
GTGAAAACCTGCTGCAGCTCACCGTTTGTGAGCTTGCCAACCGACTTGAGAACGTCATACGCCTCAGCGATCAGCTGCATGTCACCGTACTCAATACCAT
TGTGAACCATCTTGACAAAGTTTCCAGATCCACCCTTCCCAATGTATGTGACACAGGGGCCGCTGTCAGGGACCTGAGCAGACACCTTGAGAAGAATGTC
TTCAATGTACTGGTACGCCTCCAATGAGCCTCCAGGCATCATGGAGGGGCCATGGCGGGCACCCTCCTCACCCCCGGAAACACCCATCCCGAGGTAGAGG
AGCCCACGCTCCTCCATGGCCTTCTCCCTCCTTTCCGTGTTCTCATACCACTCGTTTCCTCCGTCAACGATGCAGTCGCCCTGCTCCAGGTGCGCCGCGA
GCGTCGCGATGGTCTGGTCAACCGGAGCGCCGGCCTTGACAAGCATGATGACGACACGTGGCTTCTGAATGGAGTTGACGAAGGACGCAGGGTCATGGAA
ACCGTAGAGAGGAAGGTTTCCTTCTAGCTTGGCGCGCTGGACGGTCTCATCGACTTTGGAGGTGGTCCGGTTGTACACAGAGATGGGGAAGCCTTTCTCC
GCAATGTTGAGGGCGAGGTTCTGCCCCATGACGGCGAGGCCGGCAAGACCGATTCTGGTGAGAGCCATCTTGTACCTGACCTGACCTGAGCGAGCGACGA
GACCCGCCTGCGCTGCGATGCGATGCGCGGGCGGCA
page-top