Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24713  (registered. 2007)
Contig Information
Length 2600 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 7
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27183 [Oryza sativa Indica Group]
Score 3550
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24713
TAATCCTGAGATGTCAAAGCTGCTGCACAAAGCGATTCGTGAAAAAAGTGATAATGCATACACCATCTACCAACAACATCTTGCAAGCCGTCCTGTCAAT
GTTCTTCGAGATCTTGTAGAACTAAAGAGTGAACGGACGCCTATTCCTATTGGCAAAGTTGAGCCTGCAACCTCTATCGTTGAGCGTTTTTGCACAGGTG
GAATGTCCTTGGGTGCTATTTCTAGAGAAACACACGAAGCTATTGCCATTGCAATGAATAGGATAGGTGGGAAATCTAATTCAGGAGAAGGTGGTGAGGA
CCCAATCCGCTGGAGTCCCCTTACAGATGTTGTTGATGGGTATTCTGCGACACTCCCTCATCTAAAAGGTCTTCAGAACGGGGACACCGCCACAAGTGCC
ATTAAGCAGGTTGCATCTGGACGTTTTGGTGTTACACCAACATTTTTAGTTAATGCTGAACAAATTGAGATAAAGATTGCACAAGGGGCTAAGCCTGGTG
AAGGGGGTCAACTTCCTGGGAAAAAAGTCAGTGCATACATAGCTCGGTTGAGAAACTCCAAACCTGGTGTTCCTCTCATATCCCCACCACCACACCATGA
CATCTATTCTATTGAGGATCTGGCGCAGCTAATTTTTGATCTACATCAGATCAATCCTAAAGCGAAGGTGTCGGTAAAGCTTGTAGCTGAAGCAGGAATT
GGAACTGTAGCCTCTGGAGTATCTAAGGCAAATGCAGACGTAATTCAGATATCAGGGCATGATGGTGGAACTGGAGCTAGCCCAATTAGCTCAATCAAGC
ATGCTGGGGGTCCTTGGGAACTTGGTCTTACGGAAACACACCAGACACTCATACAAAATGGATTGAGAGAGAGGGTGGTACTTAGGGTGGATGGCGGATT
CAGGAGTGGCCTAGATGTCCTTTTGGCTGCTGCCATGGGTGCTGATGTATATGGCTTTGGTTCTGTAGCTATGATAGCTACTGGATGTGTCATGGCACGC
ATTTGCCACACAAACAATTGCCCAGTTGGAGTTGCTAGTCAGAGAGAAGAGCTACGCGCTAGGTTCCCTGGTGTTCCTGGTGATCTTGTGAATTACTTCC
TCTTTGTTGCAGAGGAGGTACGAGCCACATTAGCCCAGTTGGGTTATGAGAAGCTGGATGATATAATTGGGCGGACAGATTTACTTAAGCCAAAGCATAT
CTCTTTGGTGAAAACGCAGCACATTGATCTTGCATACCTATTAATGAATGCTGGATTACCCAAATGGAGCAGCTCTCAGATAAGGAGCCAGGACGTCCAC
TCTAATGGCCCTGTTCTTGATGAGACAATCCTTGCAGATCCCGAGGTATCCGATGCAATTGAGAATGAGAAAGAGGTTTCAAAGACATATCCAATTTATA
ATGTTGATAGGGCTGTTTGCGGCCGTGTAGCGGGTGCCATTGCTAAGAAGTACGGAGATACAGGCTTTGCAGGCCAGCTGAACATTACGTTCACCGGAAG
TGCAGGGCAGTCCTTTGGTTGTTTTCTGACACCTGGCATGAATGTTCGCCTAGTAGGAGAGGCCAACGATTATGTGGGAAAGGGTATGGCTGGTGGAGAG
CTGGTTGTAGTTCCTGTAGATGATACAGGATTTGTTCCTGAGGATGCTGCTATAGTTGGGAACACTTGTCTGTATGGAGCTACGGGTGGTCAAGTATTTG
TGAGAGGCAAGACAGGAGAAAGATTTGCAGTTCGGAATTCTCTTGGGCAAGCAGTGGTTGAGGGCACAGGAGATCATTGCTGCGAGTACATGACCGGTGG
ATGTGTAGTTGTACTCGGCAAAGTTGGAAGAAACGTTGCAGCCGGAATGACCGGTGGCCTAGCCTACATGTTAGATGAAGATGATACTCTAGTCCCGAAG
GTAAACAAGGAGATTGTCAAGATGCAGAGAGTGAATGCTCCCGCTGGGCAGATGCAGCTCAAGGGCTTGATTGAGGCCTATGTTGAAAAAACAGGCAGCA
CAAAAGGCGCTAAAATTCTGAGCGAATGGGAGGCATATCTGCCACTCTTCTGGCAGTTGGTGCCACCCAGCGAAGAAGACTCGCCTGAAGCTTGTGCCGA
GTTTGAGAGAGTACTTGCCAGGCAAAAAACGGCAGTACAATCTGCTAAGTGATACTAGCCAAAGCCCAATCGCCAAAATGACCAAAGCTAAACGGAGGGA
AAGCGTTCTTACTGCGATACTTGAAAGTGATTTTCTCAGACCGCGGTCCTTCTGAAGCACTAACGTCACCAAAGGCTGCAATTTTGTGGAAGCTCTGTCC
AAGGCATCTTCTGGAAACGAGCTTGCAGATACCGTCGAGGATTCTTCTGCACGCTCTTGCAGCCTAGGTAACCAACCACCCCTGTAAATTGGTTCGCTGA
CGCTAGGCTGCAAGGCCCGGCCCCTGTTGAACTGCTGCTTTCTTGTACATGATTCCTGGCTTCGCCTGTGTAATTATATTTTTTGTTCTGCACACATTAG
TTCTTATATTTATACCCGTCCTGTGTTAGGCATGCGAGTTGCATGTGCTGTAGTTCAGTACAGAATAAGTAAAGTTTATGATGAAGTAGGAAAAAAAAAA
page-top