Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24708  (registered. 2007)
Contig Information
Length 785 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.26805e-67
Total Hit Count 351
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24708
TTTAACATCACATTCACGCAAGGAGTAAAATCCAACTTTATCACAAGAACTCACAAGCATAAGATTCTCCCTGGCGGGCAGATAATTTAAAAGCTCAGAC
AATAACCATTGTACCATGATAGCATGCGATCTACTTCAACAAAGTCTTGCATAACAAACACAGGGTGGGTATCATAATTCAAAACTGTAGCCAAATTCTA
CTACCAAACACGATTGCATAGAGGGGACTTCAACTGATCAGAATTCAGCAGGAACAGTTCCGGCAACCTGGTCCAGATCACGCCTTCCCTGGGAGGTGAT
GAGCCTTCCACCCTTGGGGTCGACATCAATGATGCCCATCTTCTGCAACTCCTGGAGGATGTTGCGGGAAACAGCACCGCTGCTCTTGCAGAAGTGCGGT
GGGCGTGAACCGTTCCTCTGACGGCCACCGTAGATCTTCTGGAAGCCGCCGATCCCGATTCCCTGCCTCAGGTAGATCTTCCTTGCCATGGAGGCAGCCC
TGATGTAGTACCAGTCAGCATCAGAAGGTGGCAGCTCCTTGAACCTTGCAGTCTTGACAATGTCAACCCACTCTGGAAGCTCCATCTTGCCGGAGCGCTT
GAGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGGGTTGACATCCTTCACGGTGCGCGCCGTGGAGGCCGCGGTCTCGGCTGCGGGAGCGGGGACGGTC
GCCATCCTGTGCTCTGGCCGGCGGCGGCGCTGTCTTCAGGAAGGAGGGAGAGGTGTGCGCGCCGCTGCGGCTGCGAGGGCTAGGG
page-top