Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24703  (registered. 2007)
Contig Information
Length 825 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays] >gi|195653093|gb|ACG46014.1| ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 448
Evalue 1.18429e-42
Total Hit Count 126
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24703
TTTTTTTTTTGTCGAAATGGGCAGCGTAAACCCAGAAGCAAGCAACAAAAACGTTGCTCAATGGAAAAAAGACCAAGAGCAGAGTTGTTCAGACTTCTAT
AGCAACAATTCCATCAACCAAAATAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAAGGGGCACAAGAAACTGCTACAGG
CAATGGACATGAAACCCGAAGGAGGAACAGTGTCATAATCTGCATTTTATTTCATGCATTGTGATGCTACAAGGAGCAAAAGCTGTGGCGCATATCAAGG
AAGATGTCTTCAAGGAAGGGTTCTCTCATAGAGAGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAA
TAGCTTTTGAATGGTGTCTGTAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCATGGAGAGGTCCATGGCGCGCTTGAGACGCTGGTGGCGGGCGT
CGACCACCTCCCGGGGCAGCCTGCAGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGGTCATACAGGTCGTCGTACCTCAGGCCGTAGTTCTTGAGGCG
GTTGGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACCACGACGAGAACGCGGACAGCATCGACGTCATCCTGGGCGAC
GGCGGCGGCGGCGGCGGCGATCCCCTTTCTCGTCTCCTCTCTTCTTCGGTGTTTGTGATTTGGGGAGGAGGAGGAGGGGAGGTGGGGTGGTTGTGGTTTC
CCTCTTGGGCCGGGGTCGTAGGAGC
page-top