Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24696  (registered. 2007)
Contig Information
Length 1558 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 8
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase beta subunit [Triticum aestivum]
Score 2109
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24696
GTCGTGCGCACCATCGCCATGGTACGGGACCGAGGGGCTCGTGCGCGGCCAGAAAGTCCTCAACACCGGATCCCCCATCACTGTGCCTGTTGGGAGGGCC
ACCCTTGGACGTATCATTAACGTTATTGGTGAGCCAATTGACCACAAGGGTGACATAAAGACACACGACTTCCTTCCTATTCATCGTGAGGCCCCTGCTT
TTGTTGAGCAAGCCACAGAGCAGCAAATTCTTGTTACTGGAATTAAGGTTGTGGATTTGCTTGCACCTTACCAAAGGGGTGGCAAAATTGGTCTCTTCGG
TGGTGCAGGAGTGGGTAAAACTGTTCTTATTATGGAGTTGATCAACAATGTTGCCAAGGCCCATGGTGGTTTCTCTGTTTTCGCTGGTGTCGGAGAACGT
ACCCGTGAAGGTAATGACTTGTACAGGGAAATGATTGAAAGTGGTGTCATTAAGCTTGATGAGAAGCAGGCTGAGAGCAAGTGTGCTCTTGTCTACGGGC
AAATGAACGAGCCCCCGGGTGCTCGTGCTCGTGTTGGTCTGACTGGTTTGACTGTTGCTGAACATTTCCGTGACGCTGAAGGACAAGATGTGCTCTTGTT
TATTGACAACATTTTCCGTTTCACCCAGGCAAACTCTGAGGTGTCTGCTCTCCTTGGACGTATTCCATCTGCTGTGGGATACCAACCAACTCTTGCCACC
GATCTTGGAGGACTGCAAGAGCGGATTACGACGACAAAGAAGGGTTCTATTACATCTGTCCAGGCTATTTATGTGCCTGCTGATGATTTGACGGATCCTG
CTCCTGCTACCACCTTTGCCCATCTTGACGCTACTACTGTGTTGTCACGACAGATTTCTGAGCTGGGCATTTACCCTGCTGTCGATCCTTTGGACTCGAC
ATCAAGAATGCTTTCTCCCCACGTTCTGGGTGTGGATCACTACAACACTGCCCGTGGTGTCCAGAAGGTTCTTCAGAACTATAAGAATCTTCAGGATATC
ATTGCCATTTTGGGTATGGATGAGCTCAGTGAAGATGATAAGATGACGGTTGCTCGTGCAAGGAAGATCCAGAAGTTCCTGAGCCAGCCTTTCCACGTTG
CCGAAGTTTTCACTGGTGCTCCAGGGAAGTATGTGGATCTTAAGGAGGGTGTTCAAAGTTTCCAGGGTGTTTTGGACGGCAAGTACGACGACATCTCCGA
GCACGCGTTCTACATGGTTGGAGGCATCGACGAAGTCATCGCCAAGGCAGAGAAGATCGCCAGCGAGAACGCTTGATGACGAGGTGTTGCCACCGCCCTG
TACAAGTTAATTTTTTTGGGATTTCAGCTGTTCGCCCGAGACTTGCTCACGAGCAGGAGTGTGCCAGCTCCTGCTGAGGGATCCTTGTTTTTGTTCGTTT
TTACTCCAATTTACCCGTAATAAGCAACTGCAGTGACATTGGTTTAGTCTGCACAACAGCAACACTACTCTTGGCTTGGAAAACACTTGTGCCCTTTGTA
ATGCAGATCCGACAGATCATGAATTGGTTTAGTTTATTGTTGTTGGCGAAAAAAAAAA
page-top