Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24680  (registered. 2007)
Contig Information
Length 792 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 10
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutaredoxin [Triticum aestivum]
Score 499
Evalue 1.34898e-48
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24680
TTTTTTTTTTGACAGTAATTTGGGGTTTGATGATATCACCAAAATAATTTGCTTTATTTCTAACGAGTTTTACACTGAGATTTAACAGTCGCTGGCGGAC
ATGCTAGACAGCAACAAGCCCTGAACTTGCCAAACACATCCAACTTCGTTATTTCATGACACGGGAACAATGCAACTCATGTAACACACTAACATGTCGA
TCACAACAACTCGCAAACAAAGCTAAGCAGTGACGGTGGTCTTCGAAGAAGAACCGGAGATCGCTCCAGCCTCTGTCAGCAGAGCAACCAGCTTCCCTCC
CTTGTTCAGTGCAATAGTATCGTCACAGCCACCGATGTGTTTTCCATTGATGAAGACATTGGGAACAGTCCTCTGCCCAGTCCATTCAGCAAGAGCTGAC
TGAATCTCAGTTCCATCGCTTTCAGTGTCCATCTCAACGGCCTTGAAACTTGCTCCAAGCTGCGTGAGCAACTTCTTCACTTGAACACAGAAAGGGCAGT
AAGACTTGCTGAAGACGACGACGGAAGCGGAGGCGACGATCTCCTTGGCCTTGGCGAGCGCCATAGCTCTGGACTCTGGGGTGGAAGAGGAGGAGGAAAA
AGCGGTACCCATCTCCGCCACGGGCGCCTTGTATTTATACGGCCGGAGGGGCGCGGGGCAGGTGAGCGGCGGGCGGCGAGGGCGCTGTGCTGGTGGGGTG
GGTCGGGGCTCGCGTAATCAGTGGGGCGTCTCCAGCCGACGACCGCGTGGGCGTGGCACGTTCCACTCACGTCGCGCGTGTGGAGACTCTCT
page-top