Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24678  (registered. 2007)
Contig Information
Length 2071 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 23
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0277500 [Oryza sativa (japonica cultivar-group)] >gi|77554291|gb|ABA97087.1| RuBisCO subunit binding-protein alpha subunit, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649074|dbj|BAF29586.1| Os12g0277500 [Oryza sativa (japonica cultivar-group)] >gi|125536273|gb|EAY82761.1| hypothetical protein OsI_37967 [Oryza sativa Indica Group]
Score 2477
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24678
TCACTCCCTCCCCCTCCCCTGCCTCCACCTTATCCTCACCTCAGCTCAGCTCACCAGCTCGCCCCCCCGCCTCCAATGGCGTCGGCCAACGCCATCTCCA
CCGCCTCCCTCCTCCGCTCCTTCTCCTCCCAGGGGAGGCCGAGGAGGTCCAAGAACGGCCGCTCCTCGCGGCTGGTGGTGCGCGCGGACGCCAAGGAAAT
CGCCTTCGACCAGAAGTCCCGCGCCGCGCTCCAGGCCGGTGTCGAGAAGCTCGCCAGCGCCGTCGGCGTCACCCTCGGCCCGCGAGGGAGGAACGTAGTG
CTGGATGAGTATGGCAACCCCAAAGTGGTGAATGATGGTGTTACCATTGCCCGTGCTATTGAGCTAGCTAACCCAATGGAAAATGCCGGTGCAGCTCTGA
TTCGTGAGGTTGCTAGCAAGACCAATGATTCTGCTGGTGATGGGACTACAACCGCTTGTGTTCTTGCCCGGGAAATCATCAAGCTGGGTATTTTGAGTGT
AACTTCTGGTGCAAACCCTGTATCGCTTAAGAAAGGAATAGACAAAACTGTCCAGGGTTTGATTGAAGAGCTTGAAAGGAAAGCTAGACCAGTCAAGGGC
AGTGGTGACATCAAAGCTGTTGCCTCTATCTCTGCTGGTAACGATGAACTAATTGGAGCCATGATTGCGGATGCAATTGACAAAGTGGGTCCAGATGGTG
TCCTTTCGATCGAGTCGTCTTCATCTTTTGAGACTACTGTTGATGTTGAAGAAGGAATGGAGATTGACCGAGGCTACATTTCCCCTCAATTTGTGACAAA
CCTTGAGAAATCAATTGTGGAGTTTGAGAACGCCAGAGTTCTTATAACTGATCAGAAGATCACAAGCATAAAGGAAATCATTCCACTTCTGGAGCAGACT
ACACAGTTGAGATGCCCGCTGTTTATTGTAGCTGAGGACATCACTGGTGAAGCTTTGGCAACTCTTGTTGTTAACAAGCTCAGAGGTATTATTAATGTTG
CGGCGATCAAAGCCCCAAGTTTCGGTGAGCGGCGGAAGGCTGTCCTTCAGGATATTGCCATCGTGACAGGCGCTGAGTACCTAGCGAAGGATCTTGGTCT
GTTGGTTGAGAATGCAACAGTAGACCAACTTGGGACAGCAAGGAAAATCACAATTCATCAGACTACAACCACCCTCATAGCAGATGCAGCTAGCAAAGAC
GAGATCCAGGCCAGGGTTGCACAGCTAAAGAAGGAGCTTTCTGAAACGGATTCCATCTATGACTCTGAGAAATTGGCTGAGAGGATTGCCAAGCTTTCTG
GTGGTGTGGCCGTCATCAAGGTTGGAGCAACAACCGAGACAGAGCTCGAGGACCGTCAGCTGCGTATCGAGGACGCGAAGAATGCCACTTTTGCAGCCAT
CGAGGAGGGCATTGTTCCCGGTGGTGGCGCGGCGTATGTGCACCTGTCTACTTACGTCCCTGCGATCAAAGAAACCATCGAAGACCATGATGAGCGCCTT
GGTGCCGACATCATCCAGAAGGCATTGCAAGCACCGGCGTCCCTGATCGCCAACAACGCCGGAGTGGAAGGGGAGGTCGTGATCGAGAAGATCAAGGAGA
GCGAGTGGGAGATGGGTTACAACGCGATGACCGACAAGTACGAGAACCTGATCGAGTCGGGCGTCATCGACCCCGCCAAGGTGACGAGATGCGCGCTCCA
GAACGCCGCCTCGGTGTCCGGAATGGTCCTCACCACGCAGGCGATCGTCGTCGAGAAGCCCAAGCCCAAGCCCAAGGTCGCCGAGCCAGCGGAGGGGCAG
CTCTCCGTCTGATCGAGCTGTCTATATGTAAAGCTCTCTTCAGGCCTCCCCCGTTTTTTTAGATTTTGCTTCAGTTCAGGCCAAGCCAAGCAGTAGAATT
TTGGTTGAGATCAACTGGAAGTGAAAAAGGTCTAGAGTAAGAGTAGGATTGCCATTTTTGCGAATCGAACGATAACCTTCCTCGCCTGATCTGAATGAAC
TCTTGTGAATCAGAGAAAATCTTCAGCATCATTTTTGAAATAAATAAATACTGATTACACCAAAAAAAAAA
page-top