Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24674  (registered. 2007)
Contig Information
Length 2499 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 21
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 3040
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24674
CGAGACGAGACCAGAGCACCCAGAACGGCAAGGGAAAACAATCAATAGTAGTCCTGTGTGTTTGACACGCCTCTTGCCACCCACCACCCAAAGACGAGAG
AAGAGAGACCAGACACCCTGATGACGACGACGATGATGTGACCTACCTAAACGGACTACGCGTAGTATGCAACCAAACGGAAAAGGAAATATCTTGGAAG
AATTTCGTCCAAATCCTCCAATGGCCACCACCAAACCCAACCCACCACTGATCATCGCACGGCGATCGGCGCTGCTCGGCTTCAGGGCTTCCACAGGATG
GTGGTCTCGGCGATCATCGAGGTGACCACGTAGGGGTCCATGTTGGACGCCGGCCGGCGGTCCTCGAAGTAGCCCTTGCCGTTCTGCTCCGTCTCCCGGC
CCACGCGCACCGACGCGCCACGGTTCGCGACACCCCAGCTGAAGGTGTTGATGTCGGCGGTCTCGTGCTTGCCGGTCAGACGGCGCTCGTTGCCCTCGCC
GTAGGCGGCGATGTGCTCCTTGTGCTTCAGCTTGAGCTTCTCGACCCTCGTGCCGAATTCGGCACGAGGGAGAGATCTTCTAGCTACACACTGTTGCCGT
CGATCCAGCAAAAATGTGCGGCATACTGGCGGTGCTGGGCTGCGCCGATGACACCCAGGGGAAGAGAGTGCGCGTGCTCGAGCTCTCGCGCAGGCTCAAG
CACCGCGGCCCCGACTGGAGCGGCATGCACCAGGTCGGCGACTGCTACCTCTCCCACCAGCGCCTCGCCATCATCGACCCTGCCTCTGGCGACCAGCCCC
TCTACAACGAGGACAAGTCCATCGTCGTCACTGTGAATGGAGAGATCTACAACCATGAACAGCTCCGGGCGCAGCTCTCCTCCCACACGTTCAGGACAGG
CAGCGACTGCGAGGTCATCGCGCACCTGTACGAGGAGCACGGGGAGAACTTCATCGACATGCTGGATGGTGTCTTCTCCTTCGTCTTGCTCGACACACGC
GACAACAGCTTCATTGCTGCCCGTGATGCCATTGGCGTCACACCCCTGTATATTGGCTGGGGAATTGATGGGTCGGTGTGGATATCATCAGAGATGAAGG
GCCTGAATGATGATTGTGAGCACTTTGAGATCTTTCCTCCTGGCCATCTCTACTCCAGCAAGCAGGGAGGCTTCAAGAGATGGTACAACCCACCTTGGTT
CTCCGAGGTCATTCCTTCAGTGCCATATGATCCACTTGCTCTCAGGAAGGCTTTTGAAAAGGCTGTCATCAAGAGGCTTATGACGGACGTTCCATTCGGT
GTTCTACTCTCTGGTGGCCTAGACTCATCATTGGTTGCAGCCGTTACAGTTCGTCACCTGGCAGGGACAAAGGCTGCAAAGCGCTGGGGGACTAAGCTTC
ATTCTTTTTGTGTCGGACTTGAGGGGTCACCTGATCTGAAGGCCGCAAAGGAGGTAGCCAATTACCTGGGGACCATGCACCATGAGTTCACCTTCACTGT
TCAGGACGGCATTGATGCAATTGAGGATGTGATTTATCACACCGAAACATATGATGTGACGACAATCAGGGCAAGCACGCCAATGTTCCTGATGTCACGC
AAGATCAAGTCACTTGGCGTCAAGATGGTCATCTCTGGTGAGGGTTCCGATGAGATTTTCGGAGGGTACCTCTACTTCCACAAGGCACCCAACAAAGAGG
AGCTCCACCGTGAGACATGTCAAAAGATCAAAGCTCTGCATCAGTACGATTGCTTGAGGGCCAACAAGGCAACATCTGCATGGGGCCTCGAAGCACGTGT
GCCATTCTTGGACAAGGAGTTTATCAATGAGGCAATGAGCATTGATCCTGAGTGGAAGATGATCCGGCCTGATCTTGGAAGAATTGAGAAATGGATGCTG
AGGAAAGCATTTGATGACGAGGAGCAACCATTCCTGCCGAAGCACATTCTGTACAGGCAGAAAGAGCAGTTCAGTGATGGTGTTGGCTACAGCTGGATTG
ATGGCCTAAAGGCTCACGCAGAATCAAATGTGACAGATAAGATGATGTCAAATGCAAAGTTCATCTACCCACACAACACCCCGACTACAAAAGAGGCCTA
CTGTTACAGGATGATATTTGAGAGGTTCTTCCCCCAGAACTCGGCGATCCTGACGGTGCCAGGTGGGCCAAGCGTTGCATGCAGCACGGCGAAGGCGGTA
GAGTGGGATGCCCAGTGGTCAGGGAACCTGGATCCCTCAGGGAGAGCAGCACTTGGAGTCCATCTCTCGGCCTATGAACAGGAGCATCTCCCAGCAACCA
TCATGGCAGGAACCAGCAAGAAGCCAAGGATGATCGAGGTTGCGGCGCCTGGTGTCGCAATTGAGAGTTGATGGTGTCCTGTCCTGCTTGCCGTTTCTGA
TAAGAAATAAGATGTACCTGGTCTTGCCATTAGAGTGGTGCAGACCTAAGGTTTGAGTGAAGATTGTGCATTAATGTTTCTATTGTTCTTATGATGATT
page-top