Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24673  (registered. 2007)
Contig Information
Length 802 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0918200 [Oryza sativa (japonica cultivar-group)] >gi|19386771|dbj|BAB86152.1| putative SUMO protein [Oryza sativa Japonica Group] >gi|113534737|dbj|BAF07120.1| Os01g0918200 [Oryza sativa (japonica cultivar-group)] >gi|125528872|gb|EAY76986.1| hypothetical protein OsI_04942 [Oryza sativa Indica Group] >gi|215692894|dbj|BAG88314.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215736955|dbj|BAG95884.1| unnamed protein product [Oryza sativa Japonica Group]
Score 463
Evalue 2.03669e-44
Total Hit Count 431
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24673
CCTCGTGCCGAGCAAACCTCAGCCGCGATCGCCGGACTTTCCTCGTTCGTTCGCGCCGACGCTGCTGCAGATCAATCCCACGCCGCGCGAGAGGCCGAGG
AGATGTCGACGCCGGGCGGGGAGGAGGACAAGAAGCCGGCGAGCGCAGGCGGCGAAGGCGGCGGCGCCCACATCAACCTCAAGGTCAAGGGCCAGGATGG
CAATGAGGTGTTCTTTCGCATCAAGAGATCTACCCAGCTGAAGAAGCTGATGAATGCCTACTGCGACCGCCAGTCTGTTGATATGAAAGCTATCGCGTTC
CTGTTTGACGGCCGCAGGCTCCGAGCCGAGCAGACCCCTGATGAGCTCGAGATGGAAGATGGCGACGAGATCGACGCCATGCTTCACCAGACCGGAGGCC
GCCTCCCTCCAAGCGCCTAGAAGAAGCCGTTGAAAGTCTTGCTCCTTGTTGGTCTACCTGATCCATCATTAGAGAGCACATGAATGAATGAAAGTCTAAA
AAGAACTTGTGAGGCTCTGGCCCCATGCCATAGCTGAAGGACATTAGGGGAGCTTTTGTTTAGTGCCGTTTGGGTACTTTGGCCTGTCATGACTCGTTTA
TCCAACCCTTAATATATCCACCTATCCAGTACTGTCTTTTTAGTACTCCCAATGATTTGAGATTGTTTTAGTTACTCGAAGCTTTCTGTGTGTTTGGTTT
CGCTTTGCTTTGCCGACAGTCCGTTCTGTCCCGTGTACGTTGGGCACACGGTGTTGGGGAGGACTAGTTTTGTGTTGCCGCTGCATGGGTATTCGAGCGA
TT
page-top