Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24666  (registered. 2007)
Contig Information
Length 1201 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193883 [Zea mays] >gi|194694366|gb|ACF81267.1| unknown [Zea mays] >gi|195606866|gb|ACG25263.1| endothelial differentiation-related factor 1 [Zea mays] >gi|195652907|gb|ACG45921.1| endothelial differentiation-related factor 1 [Zea mays] >gi|195652933|gb|ACG45934.1| endothelial differentiation-related factor 1 [Zea mays]
Score 621
Evalue 1.87209e-62
Total Hit Count 325
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24666
GTATCTAAATTCGTAGTGATGGAGATTTTCGAAGCAAATCAAAGGCTGGCTGGCTACCTTTCCCTTTAGTGTCCCCTTAGCACATTGAGCACTCTACTGA
TGACTGGCCCAACGCTTCACCTGAAAAAATAAATGAAAAATGGCGTCAAGTAATGATGCAGGTCAGCTTTTTGCAGCAATGCTTCAAGGAGAATTGGTTG
AGGGAAGTATCATCAGCTACTCACGAGAGCTCCGATTCTTAGGCCCTTGACCCTGATCCCCATGTTAGCAATCTCATTGCGTCTGGTTGAACTTTGCTTT
AAATCAAGTCTGCACAGGAGAGGGAAATTCTGTAAAAATGGTTGTTTGTATGTTTGTAAATCTTGCAATTTTCACCTCGTGCCGAATTCGGCACGAGGCG
ACCACATCCTCATCGTCTCCAACCTCGGCGAAACCCTAGCCTAGCCCCGCCGAATCGCGAGTCCCCCCGAAGCCGGAGCAAGCCGAGATGTCCCGCACCG
GACCGATCGCCCAGGACTGGGAGCCGGTGGTCGTGCGCAAGAAGCTGCCCAACGCCGCCGCCAAGAAGGACGAGAAGGCCGTCAACGCCGCCCGCCGCGC
CGGCGTCGACATCGACATCGCCAAGAAGCATAATGCTGGGACAAACAAAGCTGCTCATAGCACCACATCGCTCAATACAAAGAGGCTTGATGATGATACA
GAGAATCTTGCTCATGAGCGTGTGCCGTCAGACCTGAAGAAGAGCATTATGCAGGCTAGAACGGACAAGAAGCTCACACAGGCACAGCTTGCACAGCTGA
TCAATGAGAAGCCACAAGTCATCCAGGAGTACGAGTCAGGCAAGGCTATCCCAAACCAACAGATCATCGGCAAGCTGGAAAGGGCTCTTGGCACAAAGCT
GCGAGGCAAGAAGTGAAGCTGCGTGTGCATCTGACAGGAGTCGAGGCTTTCAAGAGAGCTTGGCTGGGCAAGTTTACCGCTAAATAAAGCTTGTCTACTA
AATCATGCGACTTAAGAAAACCCCGGAGTTTGGTATTTCGCTCAGGTTTGGGTGAATGTAATTATTAGCTTCTGTGAACAACTCTGTATCTGGGTTTCGT
TTCGTCAGCGTGTCTTCGTGAATGTGAACTGTTCTGAATGCCTGAACCTTTATATAACTTGTCTCTGTTGCCAAATGTCTCTGCATCAACACTTAAAAAA
A
page-top