Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24658  (registered. 2007)
Contig Information
Length 1336 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 23
Wh_KMV Shoot grown with continuous light after cold treatment 10
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031587 [Oryza sativa (japonica cultivar-group)]
Score 220
Evalue 6.83279e-16
Total Hit Count 36
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24658
CAACTTTCAAGGGAAAGAAGCTAAGAGTTTCTTCCTCCCAGGCTAAGAACAAGCTATTTGTTGGAAATATACCTCACAGTTGGTCATTTGATGATTTTAA
AAAAGCAGTGGAAGAAGTTGGTCCTGGAGTATTAAAAGTTGATCTGATTAAGGATCCACGTACAGATCGCATGCATTATTATAGNATTAGCCATGATGGG
CAAGAACTAGTGCAGACCACGGCTCACTTTCGACGTGTCAACATGTGAACTAGACATGGAACGAAGTATCTCTATGATATAGAACATACAAATTATCTCT
GCCTTCCAATGCCACCTTTTGCTTCTGCCCCCCATGAATAATACTGACGCGGATGTTCATTCTGTTCCCCCATGAATGTTCTCGACGCCATGTTTGCTCT
GTTCCCTTTGGTAGCCTGCTGTTTGTCGACTTTGTTCTGGCGCTCTGAATAAGTTTTGGCAGGGCACGCTCCGTTATCCAATCCGGCGTCCTGCACGCAC
ACCATGTAGGCCACAAGATCTCAGATAGCTTATGTCATTGGTGGTGGCATAAGCTACCAGTACCAGCTGCATGCCTGTGCTCTTCTTCGCTTGGAGTGTG
CCCTCGGCCATGGCCCGTGGGCGCGTACGCAGCAACCCAGGGCATGGATCCGGCGTTGGCTAGCTACCTCTGGCCTGCATCAAGCTGCAGCTGGCTAGGC
TGCTTGGTTTCTTGAGGAAGCTCGGGGTGAAACTGCCATGGCTGGCCGGCAGGGGCGGCCTCGTCCACGGCGGCGGCGGCGACTTCTCACCTCTACTAAG
GTAGGGCAACTTCTATCCTTTGGCAATTGTGACTTCTCGATCGGTAGTTGGGCGTGATGATCTCTCTCCTCCGAGTAGAGCACCGGTGGAGATCATAGCA
CGGTGCACGTGTGTGCGTATCCTCTGTATCGTCGTGTAACTACTAGCTAGCTATACCAAGTTGATATGAAGCTAGTGTGGTTGTATGTGTGATCCTGCTT
GAGTCTTTTGGTTCTGTGATCTGTGGGCAGTATATGTGTTGAGTTTTGTACGTATCTGGTAAGACTAGTGCCATCAGTCGATAAATATAAATTTGACGTT
TGCACACAGATTGTGCTTGTAAGATACTGATACTCCTCCGTTGATGTACAACGGTCGGTCGCTGCATGTTCTATTCTTCGGTTGATTTCGGAATCATACC
AATATTGTTCTGATATACTCGATCATCAGGCATCAGCACAGCACTCTCCCGGCCTTTGTTCACTTATCAATTTGTCAGGCTTAGAAACTAGTAGTAGTAC
TGGCCTTCAGAAATTGTAAGGAAAAGGGGCCGCTTC
page-top