Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24657  (registered. 2007)
Contig Information
Length 2174 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein phosphatase 2A regulatory subunit A [Zea mays] >gi|62997485|gb|AAY24685.1| protein phosphatase 2A regulatory subunit A [Zea mays]
Score 1179
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24657
TCGTTCTCCGGTTCTCCGTCCCATTCCGTCCACCGCGTCCAGACACAATCTTACCGGCGACGCCTCGCGACCTCCTCAGCTCCTCTCCCCCTTCGCCGCC
GCTGCCACCACGGGGACCCGCTCTGATCCCGTCAGGTTGTAGAAGTAACTGATTAGCCTGATGGCTATGGTCGATGAGCCTCTCTATCCAATTGCCGTGG
CTGATAGATGAGCTTAAAAATGAAGATATTCAATTGCGCCTGAACTCCATCAGAAGACTTTCCACTATTGCACGGGCACTTGGAGAAGAAAGAACCAGGA
AGGAACTGATTCCTTTCCTCAGCGAAAACAATGATGATGAAGATGAGGTGCTTCTTGCAATGGCTGAAGAATTGGGTGTGTTCATTCCTTATGTTGGGGG
TGTAGAGCATGCTCATGTTTTGCTCCCACCATTGGAGACATTGTCTACGGTGGAGGAAACCTGTGTCCGAGACAAAGCAGTTGAGTCGTTGTGCCGTATT
GGTGCACAGATGAAAGAAAATGACATTGTTGACTATTTCATTGCAGTAGTAAAGAGGCTAGCGGCTGGTGAGTGGTTTACAGCTCGAGTATCATCCTGTG
GTCTTTTCCATATAGCCTATCCAAGTGCCACCGCGTCCGTTGAAAACAGAACTGAGGACTATTTATGGCCAGTTATGCCAAGATGACATGCCTATGGTCA
GAAGGGCAGCTGCATCAAATCTTGGGAAGTTTGCTGCCACTGTTGAACAGAGCCATTTGAAGACAGAAATCATGTCGATCTTTGATGATCTTACCCAAGA
TGATCAAGATTCAGTACGTTTATTGGCAGTTGAAGGCTGTGCTGCTCTTGGAAAATTGTTAGAACCCCAAGATTGTGTAGCCCATATCCTTCCAGTCATT
GTTAATTTCTCCCAGGATAAATCTTGGCGTGTCCGTTATATGGTTGCAAACCAGTTGTATGAGCTCTGCGAGGCAGTTGGCCCTGAGCCTACAAGAGCGG
ACCTGGTGCCTGCATATGTTCGCCTCCTCCGTGATAATGAGGCTGAAGTGCGGATAGCAGCTGCCGGAAAAGTTACTAAGTTCTGTAGGATATTAAGTCC
ACAGCTTGCAATTCAGCACATTCTGCCATGCGTCAAGGAATTGTCATCAGATTCGTCTCAGCATGTTCGCTCAGCTTTGGCTTCAGTCATCATGGGAATG
GCCCCCTGTCTTGGGGAAGGATGCTACCATTGAACAACTTCTTCCTATTTTTCTTTCTTTGCTGAAGGATGAATTTCCTGATGTTCGACTGAACATAATC
AGCAAGCTTGATCAAGTTAATCAGGTCATTGGAATTGACTTGCTGTCGCAATCTCTATTGCCGGCTATTGTAGAACTTGCGGAGGATAGGCACTGGAGGG
TTCGGCTTGCAATAATTGAGTACATCCCTCTGCTGGCTAGTCAGTTAGGTGTTGGGTTTTTTGATGACAAGCTGGGGGCACTTTGCATGCAATGGTTGGA
AGATAAGGTTTTCTCGATCAGAGAAGCTGCCGCAAACAACTTGAAGCGCCTGGCGGAGGAGTTCGGTCCAGAGTGGGCTATGCAACACATAATTCCTCAG
GTGTTGGAGAAGATAAACAACCCACATTATCTGTATCGCATGACCATCCTGCAAGCTATCTCATTGCTAGCCCCTGTCATGGGTGCAGAAATAACATGCC
AAAAGCTGCTCCCTGTCGTCATTAATTCCTCGAAGGACAGAGTGCCGAACATCAAGTTCAATGTTGCGAAAGTTCTGCAGTCGCTTGTACCAATCCTTGA
TCAATCTACTGTGAAGCCATGCCTCGTCGAGCTGAGCGAGGACCCTGATGTGGATGTACGATACTATGCAAACCAGGCCCTTCAGGCGTGTGACCAGATC
ATGATGTCTAGCTAACTAAGCTACTGTCGTCACGGTTCTTTAGAAGCTATTCTTAGTCCAGCTTGGAGTACATGTAATTTACCCTTAAGAGTCTGAGAGT
TATTTCTAGCCCAGTAATCTACCTATACTTCCATGCTGATAATGGATGGGCTCTGTTCCCCTTTTGTTGTTATTAATGTTGTATAATTGAGCAACGAGAC
ACGTTGTTTTGATGGTGTGCTTAAATTGATAGTTTGAACTTGATTTCTGTCATTGCATGTGTTGGGTGGCTTAC
page-top