Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24625  (registered. 2007)
Contig Information
Length 886 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 7
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Acyl carrier protein 3, chloroplastic; AltName: Full=Acyl carrier protein III; Short=ACP III; Flags: Precursor >gi|166971|gb|AAA32922.1| acyl carrier protein III
Score 645
Evalue 1.91637e-65
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24625
AGCGATGGCCGGGGCGAGGACGGACTGGCCGGTGTCGCCGCTTCGTGGACCCCGCCGTCGATACTCCCGATGCGCCATCACTCCCCCGCGCATAAATGTG
GCAAGGTCACTTCTCCCCTCAGCTCCACCGCACCCCACCCCACCCACCCAGTCCATCCCCCGTCGCTCTCACGCTCTTCGTGCTCGCCGCCTCCCTTCGC
GTGCTGCCTCATGGCTTCCATCGCCGGATCTGCCGTGTCCTTCGCCAAGCCCGTCAAGGCAATCAACACGAACTCGCTCTCTTTCTCTGGTGCAAGGAGG
GGCAATGCATTTCTTCGTCTGCAGCCAGTGCCGATGAGATTTGCTGTTTGCTGCTCAGCAAAGCAGGATACAGTGGAGAAGGTTTGTGAAATTGTTAAGA
AGCAGCTTGCTGTTCCTGAAGGCACTGAAGTTTGCGGTACCACCAAGTTCTCTGACCTTGGAGCTGATTCACTGGACACGGTCGAGATTGTGATGGGCCT
CGAGGAGGAGTTCCAGATCAGCGTGGAGGAGACGAGTGCGCAGGCAATTGCGACAGTTGAAGATGCTGCCACGCTCATCGACAAGCTTGTCTCTGCGAAG
TCATCTTGAAGGGAGGTCGTAAATCGTAATGATTGGAGCTCGTAAGCTAGTAGTCCTACCTTGGGTTGATCCTTGTTGTTCTACCATAGTCGTTATTATA
TGGTGGGTTGGTGATTTTCTCAGGACTATCGTCTCCTGCTGTGTGTAATAAGATAATTGGTTAAGTATGTAAGCTGTTGAACATCGAAGTGCCTAGTTTT
CGTGCGGCTGTGGTGCATGTAGATGTATGCATCTTTTGTGCCCAAAAAGAAGAATATGCGGGTACGAGCCAACTGCAAAAAAAAAA
page-top