Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24620  (registered. 2007)
Contig Information
Length 2662 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 7
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hexose transporter [Hordeum vulgare subsp. vulgare]
Score 3390
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24620
AAGGCTTCCGGGGTTGGCAGGGATTCCGCCTCTTATACGCCTGCCCGCCTCGCCAGATTCCTCACAGCTTCCCTGCCCCGAGCGGAGATCCTGAACTCCG
GAGGCCGTCGTCGGGGGTAAGATTCGGCGGCCATGTCGGGCGCCGTGCTGGTCGCCATAGCGGCGTCCATCGGGAACCTGCTGCAGGGGTGGGATAATGC
GACCATTGCAGGTGCCGTCCTGTACATAAAGAAGGAGTTCAGCTTGGAGACCCAGCCCTTGATCGAGGGCCTCATCGTGGCCATGTCGCTCATCGGGGCG
ACGGTTATCACCACGTTCTCCGGGGCGGTGGCTGATGCTGTTGGTAGGCGGCCCCTGCTGATCGCCTCGTCTGTCCTCTACTTTGTCAGTGGCCTGGTGA
TGCTCTTGGCGCCCAACGTCTATGTGTTGCTCTTGGCCAGGCTCATCGACGGGTTCGGTATCGGTTTGGCTGTCACCCTTGTCCCTCTTTACATTTCGGA
GACCGCCCCGACTGACATTAGAGGGCTGCTGAACACGCTGCCGCAGTTCAGTGGTTCAGGAGGGATGTTCCTTTCTTACTGCATGGTGTTCACCATGTCG
CTCATGCCACAGCCTGACTGGAGAATCATGCTTGGGGTTTTGTCGATCCCGTCGCTTATGTACTTTGCATTGACTGTCTTCTATTTGCCCGAGTCGCCGA
GATGGCTTGTGAGCAAAGGAAGAATGGCCGAGGCCAAGCGAGTGTTGCAAGGACTGCGGGGAAGGGAAGATGTCTCAGGAGAAATGGCCCTTCTTGTTGA
AGGATTGGGTGTTGGGAAAGACACACATTTTGAGGAATACATAATTGGGCCTGATGATGAGCTTGCTGATGACGGTCTGGCTCCAGATGAAGAGAAGTTG
AAGCTGTACGGAGCTGAAGAAGGGGTATCTTGGATCGCCCGTCCTGTTAGGGGCGGTGGCCAAAGTGCACTTGGAAGCGCCTTGGGTCTCATGTCTCGTC
ATGGGAGTATGGTTAGTCAGGGTAAATCTCTCGTGGACCCACTTGTCACTCTCTTCGGAAGTGTCCATGAGAAGATGCCTGAGGTAATGGGGAGCATGCG
CAGCACATTGTTTCCTAACTTTGGCAGCATGTTTAGCGTGGCAGAACAGCAGCAGGCTAAAGCTGACTGGGATGCTGAGAGTCATAGGGATGATGAAGAT
TATGCATCGGATCATGGTGCTGATGACATTGAGGATAGCCTCAATAGCCCGCTTATTTCTCGTCAAGCGACAAGCGTGGAGGGTAAGGAGATTGCTGCAC
CTCATGGAAGCATAATGGGTGGTGTGGGAAGAAGTAGCAGCATGCAGGGAGGGGAGGCAGTAAGCAGCATGGGCATTGGTGGGGGGTGGCAGTTAGCTTG
GAAGTGGACTGAGAGAGAAGGTGCAGATGGGCAAAAGGAAGGCGGCTTCCAGCGTATTTACTTGCATGAGGAGGGCGTGTCAGGTGATCGGAGGGGCTCT
ATATTGTCTATGCCAGGAGGTGATATTCCTCCTGGTGGTGAGTATATCCAGGCAGCCGCTCTAGTGAGCCAACCTGCTCTTTATTCGAAGGACCTGATAG
AGCAGCAGCTTGCTGGTCCTGCCATGGTACATCCATCTGAGGCAGTTGCCAAGGGTACAAAATGGGCAGAACTATTTGAACCTGGAGTGAAGCATGCACT
GTTCGTTGGCATAGGATTACAGATCCTGCAGCAGTTTGCGGGTATCAATGGAGTCCTCTACTACACACCTCAGATACTTGAGCAAGCAGGTGTCGGGGTT
CTTCTATCAAACATTGGACTAAGCTCTTCCTCTGCATCTATTCTTATTAGTGCCTTGACAACCTTGCTGATGCTTCCCAGCATTGGCATCGCCATGAGAC
TCATGGATATGTCAGGAAGAAGGTTTCTTCTCCTTTCGACAATCCCTGTCTTGATAGTAGCACTAGCTGTCTTGGTTTTGGTGAATGTTCTGGATGTCGG
AACCATGGTGCACGCCGCGCTCTCAACGATCAGCGTCATCGTCTATTTCTGCTTCTTCGTCATGGGGTTTGGGCCTATCCCAAATATTCTCTGCGCGGAG
ATTTTCCCCACCTCCGTCCGTGGCATCTGCATAGCCATCTGCGCGCTAACCTTCTGGATCGGCGACATCATCGTGACATACACTCTCCCCGTGATGCTCA
ACGCCATCGGTCTCGCTGGAGTCTTCGGCATATATGCCATCGTTTGCATACTAGCCTTTGTATTCGTCTACATGAAGGTCCCTGAGACAAAGGGCATGCC
CCTGGAGGTCATCACCGAGTTCTTCTCTGTCGGGGCAAAGCAGGGCAAGGAAGCCACGGACTAGTTGCTCTGATCCGGTGATCCGCGTCGCTGGTGGTAA
TTTTGTGGTGTCATAACTACTACTACACTGGTTAACCTGCGATGCTTTGGTGAAGAAACTTCAAAGAGAGCAGATACGGAAGACTTTACATCGTGAGGCT
GAATCGTGTCGTCGTAGGCCGGCTTTTGGAAGTAGGATATGTACTTAGATCATCTGTTCTTTTCGCTTTGGAACTTTCTATTTGTGTTATTCAGAATTTC
TTGCCCATGTAACTAGTGCTGTTATCACAATTTATGTTGTTTATGTTTTTTCAAAAAAAAAA
page-top