Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11976  (registered. 2012)
Contig Information
Length 574 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050550|ref|XP_002463019.1|| hypothetical protein SORBIDRAFT_02g036310 [Sorghum bicolor]
Score 219
Evalue 2.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11976
GTATATATCCGGGCACAAAGGAGCCCAAACTTCATAAAAAGAAAAGGAAACTGGGAATGATTAGTGACGCACTGATTGTTCGTCATCATCCTAGGTAGTA
TGGCAATTATAATACAGAAGAAGACAAATGAAAAATCAGACGAGGACTCAAAAAAGTCCTCGATCGGCCTCGGATGGTAACAGCTTATTGGCCAGCGACG
ACGTTTCGACGTCACGGGAGCTTGGCAGCCTGGACCTTGCCGTTGGAGCGCATCTCGACGTCTGCGCCGCCGACGTGCACGTCCTCGTCGCGGATGAAGC
GGCCCCAGTACCAGTGCGCCTTCCACACGAGCACCATCTCCTCGATGGGCACGTTCTTGGTCTCCGGCAGGAAGTAGGCGACGAAGAGGGTCATGACGAC
CACCCACGCGCCGAAGAAGAAGAAGAGCATGAACTTGAAGCGGCAGAGCATGGGGAGGAACGCCTGCGCGATGATGAAGGTGCACAGCATGTTCATCGAC
ACCGTGATGCTCTGCCCCGCCGACCTGATCTCCAGCGGGAAGATCTCGCTGGGGACGAGCCACCCCAGCGGGCC
page-top